ORFeome > asz1 ORF1 – XORFeome v1.0

asz1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: asz1
Gene ID: 986018
Gene Page ID: 986014
ORF Xenbase ID: 17265297

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130183
Original XGC clone length: 1416

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ837774
dbEST ID: 79655476
Trimmed Sequence: ATGGCGCTGAGCAGGTATCAGGTGGTACCTGGCGGCGGGGAGAGCAGTGGTAGTGATGACGGCTGGGATATGGGGGAAGTGCGAGAACCAGACGAGAAAATTGACAAGAACCCAGTGAATGAAAGCAATGAAGATATATTTAAGAAAGCTCTTACTACTGGAAATGTGAAAATAGTGGAACAACTTTTAAAGTCAGGTTTGAATGTGGAGTGCTGCTTTCAATTTGGATGGACTCCATTAATGTATGCAGCTAGTGTAGCAAATCTGGAGATGATACGTCTTCTACTGGACAGAGGTGCAAATGCAAGCTTTGAAAAAGATAAATTCACTGTCCGTATGGCTGCATGTACTGCACATTCTTCAGAAGAAAAGATTGTGAAATGTGTGGATCTGCTTCTCTCAAGGAATGCTGATCCAAATATTGCGTGCCGGAAGCAAATGACGCGACTTATGTATTCAGCTCGAGAAGGGCACCCTCAACTGGTTTCACTTCTTGTTGCTCATGGAGCAGATATACATGCACAGGATGAGGATGAATATACTGGGCTACCATGAACAGGAGATGATTGAGAGAGAGAATAATATTTTGATGATGCTAGAACTGGGAGCTGGGTGGACATTCTCAACCAACACAGAAGAAAGACCCGCCGAGGTGGGGGGGAAATAGAACGTTTTTCATATCTTCGGCCGGGGGTTCGTTAATTATAAAAAAAGAAAGGA
Full Trace Sequence: GGCCCCAAATAATGGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAGCAGGTATCAGGTGGTACCTGGCGGCGGGGAGAGCAGTGGTAGTGATGACGGCTGGGATATGGGGGAAGTGCGAGAACCAGACGAGAAAATTGACAAGAACCCAGTGAATGAAAGCAATGAAGATATATTTAAGAAAGCTCTTACTACTGGAAATGTGAAAATAGTGGAACAACTTTTAAAGTCAGGTTTGAATGTGGAGTGCTGCTTTCAATTTGGATGGACTCCATTAATGTATGCAGCTAGTGTAGCAAATCTGGAGATGATACGTCTTCTACTGGACAGAGGTGCAAATGCAAGCTTTGAAAAAGATAAATTCACTGTCCGTATGGCTGCATGTACTGCACATTCTTCAGAAGAAAAGATTGTGAAATGTGTGGATCTGCTTCTCTCAAGGAATGCTGATCCAAATATTGCGTGCCGGAAGCAAATGACGCGACTTATGTATTCAGCTCGAGAAGGGCACCCTCAACTGGTTTCACTTCTTGTTGCTCATGGAGCAGATATACATGCACAGGATGAGGATGAATATACTGGGCTACCATGAACAGGAGATGATTGAGAGAGAGAATAATATTTTGATGATGCTAGAACTGGGAGCTGGGTGGACATTCTCAACCAACACAGAAGAAAGACCCGCCGAGGTGGGGGGGAAATAGAACGTTTTTCATATCTTCGGCCGGGGGTTCGTTAATTATAAAAAAAGAAAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAGCAGGTATCAGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837773
dbEST ID: 79655475
Trimmed Sequence: TAGGGAACAGTCCCTATTTACCTTCACAAGTAAAAAAATAAAACCAAAGCTTAAGAACATTGCAGCAGACATTTTCAGCAGCCCATACTTCCTCCATCCATTCTGATCTTCCAAGGGTGGCACACGACATGGTGTATTTTGCTGTCCTTTTTTGAACTTAGTCAAAAGACACTGCAAACTGTAAACTTCTTTGTTGAGATCAGCTACACTTGTGACAATATCTTCACACACAGAAGTGAAGTTCTGCGTATAGTCCCACTCCAAAACAATATTCTGTGGATTCAAAGGTATTTGGTCATTAACCGCTCTGACTGTTTGGGTAAGGCAGTTGCACTGTCTATTAAGTTTAAGAAGAAATGCAAAAAGCTCATCACTGGATTCTAAGTTCAGAAATGTGGAAAACTCCTCAAGCCTTGCATCTTCAACTTGAATTTCTTTCACAGCAACAACAATTTTCTTACAATCCACTTCACAGCTAATGCCAACCTTTTTGAGTTCCTCTTCCTTAAAATGTAACAGTTGCCTTAGCGTTATATCGTTCTCCTTAAACAGTTCTGTCAGGTGTTCCAAATCCAAGCCACCCAGAAACACCTCTAGATCACTGGATGTTGAGTAACTTGTATGCTTCAACTCCTGGTCCGGCTGAATTTTCAGATATCTATAGATGGCCTCTTCTCTGTTTAAAGTCACCTTACCTTGACCCATATTTGCAGAAAATGAAAGAATGCTGAAAATCTCTAAATGGTTGAATTTCCTTGCTATTTCTGCAGGTGTCTCACCAATTTTTGTTGACCACGTTTTATCAGCTCCCAGTTCCACCATTTTCCAAAAAATATTCTTTCTCCCATCCTGTGCTGCCCATGCTAGCCCTGTATAACCCTTTTCATCCTGTGGATGTATATTTGCTCCATGTGCAACAAAAGTGAAAACACTTGAAGGGTGGCCTTCTCGAACCAAAAAACATAATTGGTGGACTTTTGCTTCCGCCACCAAAATATTGGAAAAACCATTCCTTTGAAAAAACACAAAACCAAAAAATTTCACAAATTTTTTTCTTTTCTAAAAAAAATTGACAAGAAATGGACAGCCCAAAAGGAAAAAAGGGAAAATTATAACTTATTTTTTAAAAAATTTGTCTGTTTTTTCCCCCCCTCTCCCTCCCCAAGAA
Full Trace Sequence: TGCCAGGGAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGGGAACAGTCCCTATTTACCTTCACAAGTAAAAAAATAAAACCAAAGCTTAAGAACATTGCAGCAGACATTTTCAGCAGCCCATACTTCCTCCATCCATTCTGATCTTCCAAGGGTGGCACACGACATGGTGTATTTTGCTGTCCTTTTTTGAACTTAGTCAAAAGACACTGCAAACTGTAAACTTCTTTGTTGAGATCAGCTACACTTGTGACAATATCTTCACACACAGAAGTGAAGTTCTGCGTATAGTCCCACTCCAAAACAATATTCTGTGGATTCAAAGGTATTTGGTCATTAACCGCTCTGACTGTTTGGGTAAGGCAGTTGCACTGTCTATTAAGTTTAAGAAGAAATGCAAAAAGCTCATCACTGGATTCTAAGTTCAGAAATGTGGAAAACTCCTCAAGCCTTGCATCTTCAACTTGAATTTCTTTCACAGCAACAACAATTTTCTTACAATCCACTTCACAGCTAATGCCAACCTTTTTGAGTTCCTCTTCCTTAAAATGTAACAGTTGCCTTAGCGTTATATCGTTCTCCTTAAACAGTTCTGTCAGGTGTTCCAAATCCAAGCCACCCAGAAACACCTCTAGATCACTGGATGTTGAGTAACTTGTATGCTTCAACTCCTGGTCCGGCTGAATTTTCAGATATCTATAGATGGCCTCTTCTCTGTTTAAAGTCACCTTACCTTGACCCATATTTGCAGAAAATGAAAGAATGCTGAAAATCTCTAAATGGTTGAATTTCCTTGCTATTTCTGCAGGTGTCTCACCAATTTTTGTTGACCACGTTTTATCAGCTCCCAGTTCCACCATTTTCCAAAAAATATTCTTTCTCCCATCCTGTGCTGCCCATGCTAGCCCTGTATAACCCTTTTCATCCTGTGGATGTATATTTGCTCCATGTGCAACAAAAGTGAAAACACTTGAAGGGTGGCCTTCTCGAACCAAAAAACATAATTGGTGGACTTTTGCTTCCGCCACCAAAATATTGGAAAAACCATTCCTTTGAAAAAACACAAAACCAAAAAATTTCACAAATTTTTTTCTTTTCTAAAAAAAATTGACAAGAAATGGACAGCCCAAAAGGAAAAAAGGGAAAATTATAACTTATTTTTTAAAAAATTTGTCTGTTTTTTCCCCCCCTCTCCCTCCCCAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGGGAACAGTCCCTATTTACCTT