ORFeome > atad3a ORF1 – XORFeome v1.0

atad3a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atad3a
Gene ID: 946134
Gene Page ID: 946128
ORF Xenbase ID: 17265309

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060012
Original XGC clone length: 1782

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAGAAGACACATTGATGTATTGTTATATTGTATATCTGTATGAGTGCACCGTGCTCTGCGTACGCAACAATATATAGATAGACGCATGTGTCTTGTTTATATAAGTGCTCTGTCTTCTGATACAAATAAGAGTGTGCGCAGGCAGTGCGTCTGGCACGTCGTGTAACTCAATGGGTTACTTTATTAGATCGCCATACCGCCGGATTATCTAATGGACCGCACCACTAGATGCTGTCAGGAATGCTCGAGTGTAACGACGCATGACAAGCGAAGGATGGCACGCGAGTCGGAGTATGTCTAATATGTATGACTGGCACTTGCCTCGACAGAGGACTCGTTTACTCTGTCTGCCGTGGACAGTCGTATAGTTGCTGTAGTCACAACACACTCGTTAGGACAAAGATCACTTGTATGACTGTATTTAGAAGATCCAGAACTTGTACAACGGCAAGCTTGTGATAAAAGATCGATACCTGCGCGAGCTTATACACGCTACATACCATCTCTTCATATGGATGGTAGATAGGAACGTGACGTGAAAGCTCTCTGAATGGGCTGCAAAGAGACTACTACGACGGGTCTGTATTGTATCTGAATATATTCAGGCAATCGTGCGCGAACGCAGGAGTGTAGATACAGAGATACATCATTATATTAGACCTTACGTAATGTATAAAGTAGTGTGTTATCATCATACTCGGTATGCGACGATCATTCTTGCGTCGAGGAGCACAGTATTCCTACTTGGTATTCCATTACGTATGTTAGTCGGCTATACTTCATGAGCATGCTCGGGTGTTGGAGAATAACTCAAGAGACAAGCTACTCGGAGATACTAGATTTACTCTTGGGCACTAACACTGAATGCCTCAACTCGACCCATATAGTGCATACGCCCTAGTGCAGCAACGAACTTGAGGGGGGACCTCGATACTAGTGTAGGAAAGCTTCGATGGATCTATACAATATTGGCAGTCAGGTAAACCCGGGAAACTCACTTTTAAATTAGAAGAATTATTCTTGTAAGAAGTATGCGATCGCCGATGTGCCAAAGACAACAGGATACCTCTAAAAGGCCCTGAAAATGGGAGATCCTTGGAAGGTGTGCCGGGTGCAAGTTTGGAGAGGAAATTCTTCTTTTTTTGCTCGGAAAGCATACACAAATAGCATATAANAAAGACGGGGTGTCCACGACCGGACATTTGGGGCGGAAAGAGAGTGTTGGGAGAGAGGTTCCTCTTTTCTTAGTGGGGCTCTGGGGTGGGGGACGGGGAAAGAAAAGTAGGAAACTTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTGGTTATTTGGTCTTAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ830108
dbEST ID: 79647810
Trimmed Sequence: AACTGGGGTGCCTTCCAGAAGAGGCTGCAGTGGGTTTTTCCCAATTTCTTTAGTACTTTCCTTGCCCCTCTGCCTTTAGCCACTCCATCTTTTGCTGGTGCTGCCGTATCGCATCAGCCACGCGAGCATCAATCATGGCTTCCGTCAGAATTCCATCTTCAGAGGCATAAGCTGCCGCCTGCCATGCAACTCCTAGCTTGGAAATCTCACGGCCAGACATGCCTTCAGTGAGTGTGGCAAGCTCAGAACACTTTTTGCCATAGTCGAATTGTGCAACTTTTAAACGCTGCTTGCCTTCTGATGCTGGTTGTAACACATATTTATCAAAATAAAGTCTGACCAGGCGCTCTCGCTCTTCCAAACCAGGAAGGTCAAAGTGGACTATTTCATCTATTCGGTCATTAATGGCCCAGTCAAACTGTTCAGGTTGGTTACTAGCCAGTACAAGCATAAACTTGTTACTCTGTTCTCCTGTTCTATACAGAAAAGCATTTAATGTTGCTCTGAGGTCTTCACTGATCTTCTCTGTGGATCTTTTTCTTAGAAAGGCATCAGCTTCATCCACAAATAGTAGAAAGGCTCTTTTGCTAGTTGCTGCCCAGTCNAAGACTTTATGCATTGCAGTAACACCTTTCACGCCCCCTGGGGGCGACATCACCCCCCCGTCCAGGAGGGCGTAATCCCATGGCTAAATGGGGGGGGCTATTCCTTTTACCAAAAAAGGTTTTTTCCCCTTCCCCGGAAGGACCAACAACACAAATTATTTCCTATAAAGGGCCTTTGTGTTTCTT
Full Trace Sequence: TACGGGAAACTGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACTGGGGTGCCTTCCAGAAGAGGCTGCAGTGGGTTTTTCCCAATTTCTTTAGTACTTTCCTTGCCCCTCTGCCTTTAGCCACTCCATCTTTTGCTGGTGCTGCCGTATCGCATCAGCCACGCGAGCATCAATCATGGCTTCCGTCAGAATTCCATCTTCAGAGGCATAAGCTGCCGCCTGCCATGCAACTCCTAGCTTGGAAATCTCACGGCCAGACATGCCTTCAGTGAGTGTGGCAAGCTCAGAACACTTTTTGCCATAGTCGAATTGTGCAACTTTTAAACGCTGCTTGCCTTCTGATGCTGGTTGTAACACATATTTATCAAAATAAAGTCTGACCAGGCGCTCTCGCTCTTCCAAACCAGGAAGGTCAAAGTGGACTATTTCATCTATTCGGTCATTAATGGCCCAGTCAAACTGTTCAGGTTGGTTACTAGCCAGTACAAGCATAAACTTGTTACTCTGTTCTCCTGTTCTATACAGAAAAGCATTTAATGTTGCTCTGAGGTCTTCACTGATCTTCTCTGTGGATCTTTTTCTTAGAAAGGCATCAGCTTCATCCACAAATAGTAGAAAGGCTCTTTTGCTAGTTGCTGCCCAGTCNAAGACTTTATGCATTGCAGTAACACCTTTCACGCCCCCTGGGGGCGACATCACCCCCCCGTCCAGGAGGGCGTAATCCCATGGCTAAATGGGGGGGGCTATTCCTTTTACCAAAAAAGGTTTTTTCCCCTTCCCCGGAAGGACCAACAACACAAATTATTTCCTATAAAGGGCCTTTGTGTTTCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACTGGGGTGCCTTCCAGA