ORFeome > atf4-iii ORF1 – XORFeome v1.0

atf4-iii ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6253265
Gene Page ID:
ORF Xenbase ID: 17265333

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC123223
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCACACAATAATAGATTTTATTTTCGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTTGGGGGACCTTATGTCCCCCTTCAACCAGTCATTTTTGGCGGCTGAAGAAATTTTGGGTGTCTTGGAGGATGACATTGAGGTGCCCGGGTACCTCCAATCGCGTGGGTTCTCCAGCGACAAGGCGAAAGATGGCGTCTCTGAGGTGCTGCCTTATGTTGAATCCTTAAGCCGTTTTAATGGGGATGCCTTCTCGGGCGTGAATTGGATGGTGGAAAATATGGATCTCAAGGAATTTGATTTAAACTCCCTATTTGGAGAGGAAGATCTGCAGTCCACTATCTCACGCCATAAGCTAACATCACCGTTGGAAGACTCATGTGATTTACTAAAGGACCCACCTCAACCATCACTGATTGGTCACTTTGTGGGATCACCAAAACCAGTCGCTCTACCAGGGTCCCCTCTTTATGCCGATCAGGATGCCCCAATTATTCTAAATTTAACAAAGTCACTCCTTAAACCCGGACCATTCCTTTATCTTGGAGGTAGGGGGGCGGCTTTATTGTAGGAAGTAAACATTAGGAAAAAACATTGCTTATGAGTTTGTTTGGACGAAGGAAGTCACAGTGCGTAAAAAATACAACGATTATTTGCTTTACGGCCGAAATAACCGGGCGGGAGCTCCTNNNTTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATATATAAGGGACTGTCGGGACATCCAAAAACAAAAGGAAAAAACTTACCTCGCTCTTTGTTTTTCGTGGTGGGTGTGCCGGGGGGAACGTGTGAAAAAGAAAACCCCGGGCGAAAAAGGCAGTTTTGGTTGAGGTTGGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTTGGGGGACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838316
dbEST ID: 79656018
Trimmed Sequence: CCTACATCCAAGATAAAGGAATGGTCTGGGCCTAAGGAGAGACTCTGTTAAATCTGGACTAACTGGGGCAACCTGATCAGCATACAGTGGGGACCCTGGAAGAGAGACAGGTTCTGGTGATGGCACAAAGTGACCAATCACTGATGGATGAGGTGGGTCCTCTAGTAAATCACATGAGTCTTCCAACGTTGATGTTAGCTCATCTGGTGAGATAGTGGATTCCAGATCTTCCAATCCAAATAGGGAGTCTAAATCAAATTCCTTCAGATCCATCTTTTCCACCATCCAATCCATGCCCGAGAAGGCATCCCCATTAAAACTGCCTAAGGATTCAACATAAGGCAGCAGGTCAGAGATGCCATCCTTAGCCTTGTCGCTGGAGAACCCTTGCGATAGGAGGTACCCGGGCACCTCAATGTCATCCTCCAAGAGACCCAAACTTTCTTCAACCGCCAAAAACGACTGGTTGAAGGGGGACATAAAGTCCCCCAACAGCATGATGCCAACTTTGTTGTACAAAGTTTGCATTATAAAAACACATTGCTCTCACTTTGTTGCACGAACAGGTCACTATTCATTCAAAATAGATCATTATTTTNGGGAAGAAAAAAAAAATAACCAAATTTTTACATATGTACCCCTGGGCTCCCGAGGAAAAAAAAGCCCACGCCCCCCCCCCCCCCCCGTGGTTGTTGGGTTTCCGGGGGGAAA
Full Trace Sequence: GGGGAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCTACATCCAAGATAAAGGAATGGTCTGGGCCTAAGGAGAGACTCTGTTAAATCTGGACTAACTGGGGCAACCTGATCAGCATACAGTGGGGACCCTGGAAGAGAGACAGGTTCTGGTGATGGCACAAAGTGACCAATCACTGATGGATGAGGTGGGTCCTCTAGTAAATCACATGAGTCTTCCAACGTTGATGTTAGCTCATCTGGTGAGATAGTGGATTCCAGATCTTCCAATCCAAATAGGGAGTCTAAATCAAATTCCTTCAGATCCATCTTTTCCACCATCCAATCCATGCCCGAGAAGGCATCCCCATTAAAACTGCCTAAGGATTCAACATAAGGCAGCAGGTCAGAGATGCCATCCTTAGCCTTGTCGCTGGAGAACCCTTGCGATAGGAGGTACCCGGGCACCTCAATGTCATCCTCCAAGAGACCCAAACTTTCTTCAACCGCCAAAAACGACTGGTTGAAGGGGGACATAAAGTCCCCCAACAGCATGATGCCAACTTTGTTGTACAAAGTTTGCATTATAAAAACACATTGCTCTCACTTTGTTGCACGAACAGGTCACTATTCATTCAAAATAGATCATTATTTTNGGGAAGAAAAAAAAAATAACCAAATTTTTACATATGTACCCCTGGGCTCCCGAGGAAAAAAAAGCCCACGCCCCCCCCCCCCCCCCGTGGTTGTTGGGTTTCCGGGGGGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTACATCCAAGATAAAGGAATG