ORFeome > atp11c ORF1 – XORFeome v1.0

atp11c ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp11c
Gene ID: 976442
Gene Page ID: 976438
ORF Xenbase ID: 17265399

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053328
Original XGC clone length: 3384

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: E05

Sequences - 5ʹ (forward) EST

Accession: JZ824365
dbEST ID: 79642067
Trimmed Sequence: ATGTTCCGCCTGGGCTGCATTTGGCTGTGTCCTGGAGAATAAAACCGTGTTGGAACTCTCACTGTGTATGTTGGACCTCGGCCAGCTTCAGATAACGATGCCTATATCCAACCGAAATTCTGTGATAGTAGGATTGTCTCTTCCAAGTATACCGTGTGGAACTTTATCCCCAAAAACCTGTTTGAGCAGTTTATAAGAATTGCCAATTTTTATTTTCTCATCATATTTCTTATTCACGCTATTGTACACACACCAACAAGTCCAGTAACCAGTGGCCTTCCTCTCTTTTTTGTTATTACTGTCACATCCATTAAACAGGGCTATGAAGACTGGTTGCGGCATCGAGCACACCATGAAGTCAATAAAAGCACTGTCTACATTATTGAGGGTTCCAAATGTGTCAAAAAAGAGAGCGAACAAATTAATGTTGGCGACATACTGCAAGTCATACACAATGAGACCTTCCCATGTGATCTACTCATGTTGTCTACTAGCTGCCGGGATGGGACCTGTACAGTTACAACAGCAAGCCTTGATGGGGAGTCCAACTTTAAGACCTATCATGCTGTGCCAGAAACTGCTATCATGGGCTCTTATGAACATCTAAATGCTTTTTCAGCCACCATTGAATGTGAACAGCCTCATCCTGACTTATACATCTTTCATGGACGACTACATGTGAACATCTAACAAGATGTCATAGCGAGGTCTTCGTGCTCCTGAACATTTGCATGCTCATGGAGNCGACTTGAACAATACAAAGAAGAAATTCGGGTGTTTCCGGAAAAACTGACATGGCAACAAAAATGGTAATA
Full Trace Sequence: AATGGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTCCGCCTGGGCTGCATTTGGCTGTGTCCTGGAGAATAAAACCGTGTTGGAACTCTCACTGTGTATGTTGGACCTCGGCCAGCTTCAGATAACGATGCCTATATCCAACCGAAATTCTGTGATAGTAGGATTGTCTCTTCCAAGTATACCGTGTGGAACTTTATCCCCAAAAACCTGTTTGAGCAGTTTATAAGAATTGCCAATTTTTATTTTCTCATCATATTTCTTATTCACGCTATTGTACACACACCAACAAGTCCAGTAACCAGTGGCCTTCCTCTCTTTTTTGTTATTACTGTCACATCCATTAAACAGGGCTATGAAGACTGGTTGCGGCATCGAGCACACCATGAAGTCAATAAAAGCACTGTCTACATTATTGAGGGTTCCAAATGTGTCAAAAAAGAGAGCGAACAAATTAATGTTGGCGACATACTGCAAGTCATACACAATGAGACCTTCCCATGTGATCTACTCATGTTGTCTACTAGCTGCCGGGATGGGACCTGTACAGTTACAACAGCAAGCCTTGATGGGGAGTCCAACTTTAAGACCTATCATGCTGTGCCAGAAACTGCTATCATGGGCTCTTATGAACATCTAAATGCTTTTTCAGCCACCATTGAATGTGAACAGCCTCATCCTGACTTATACATCTTTCATGGACGACTACATGTGAACATCTAACAAGATGTCATAGCGAGGTCTTCGTGCTCCTGAACATTTGCATGCTCATGGAGNCGACTTGAACAATACAAAGAAGAAATTCGGGTGTTTCCGGAAAAACTGACATGGCAACAAAAATGGTAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCCGCCTGGGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829724
dbEST ID: 79647426
Trimmed Sequence: TAATAAGGTGTTTAATTTGTACTCCTCAGTTTTCATTCTCAAAATGAATCCATTCTCCATACTCTTGTATGAAATTAGCTCTGGAGGCCGATATGAGATCCTCTTTTGGCCCGCAGTTTTAAGATTTTTGATTAATATCAAAATAATCTCTGGGTAAAGACTGACAAAAATCAGTAAAATTATCCCAAGCCAGATTGACACAGATGTCAGTATGTTAGAAAACACAGAGTACATTCTCTGCTGTTTGAGGAATGGCCAAATAATTCCTCCCCAAAATAAAGAGAAAATAACATAAAATGCTAATGAGCCCCATATAACCAAATGGTTCAACCATGTCCAGTATCAAGTATCCAAAGCAAGCTTAAATGTAACTGTAAACACTAATATAGTGAACACCATTGTTCCAAATGACCAGTTTCCAAACACCTGTCCATTGCCTTCCAGAGCTGGATTCTGAAAGAGGAAGTAAACCCCAAAGAAAAAAACTAGTCCTTCAAATGCCCCCAGTAATGTCCAGTATAGGAATGGACCCCACTGCAGCATGGCATTGTCAGATATCCTCATATATAATTTACGATTTGTGGATAGGATTTCTATATTAATGTGCTGCTCCAATAAGCTGTATGCCAAGATTGGCATAGAGGTGAAACAAATGTTGTACATAGTCATGATTGCAGCATCAAAAAGTGTCTGTTGTGAAAAGGCACAAAAGGAACCGGTTAAAAAAAACTGTGGGCAAATTGAAAACCAAAAAATTCTTT
Full Trace Sequence: ACGAGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATAAGGTGTTTAATTTGTACTCCTCAGTTTTCATTCTCAAAATGAATCCATTCTCCATACTCTTGTATGAAATTAGCTCTGGAGGCCGATATGAGATCCTCTTTTGGCCCGCAGTTTTAAGATTTTTGATTAATATCAAAATAATCTCTGGGTAAAGACTGACAAAAATCAGTAAAATTATCCCAAGCCAGATTGACACAGATGTCAGTATGTTAGAAAACACAGAGTACATTCTCTGCTGTTTGAGGAATGGCCAAATAATTCCTCCCCAAAATAAAGAGAAAATAACATAAAATGCTAATGAGCCCCATATAACCAAATGGTTCAACCATGTCCAGTATCAAGTATCCAAAGCAAGCTTAAATGTAACTGTAAACACTAATATAGTGAACACCATTGTTCCAAATGACCAGTTTCCAAACACCTGTCCATTGCCTTCCAGAGCTGGATTCTGAAAGAGGAAGTAAACCCCAAAGAAAAAAACTAGTCCTTCAAATGCCCCCAGTAATGTCCAGTATAGGAATGGACCCCACTGCAGCATGGCATTGTCAGATATCCTCATATATAATTTACGATTTGTGGATAGGATTTCTATATTAATGTGCTGCTCCAATAAGCTGTATGCCAAGATTGGCATAGAGGTGAAACAAATGTTGTACATAGTCATGATTGCAGCATCAAAAAGTGTCTGTTGTGAAAAGGCACAAAAGGAACCGGTTAAAAAAAACTGTGGGCAAATTGAAAACCAAAAAATTCTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATAAGGTGTTTAATTTGTACTC