ORFeome > atp1a1 ORF4 – XORFeome v1.0

atp1a1 ORF4 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp1a1
Gene ID: 6254180
Gene Page ID: 484830
ORF Xenbase ID: 17265435

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125976
Original XGC clone length: 3072

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CTCGGGGGCCAGATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGATACGGGGCCGGAATCAAGGTTATCATGGTAACAGGTGACCACCCAATTACAGCCAAGGCCATTGCTAAAGGAGTGAGAAACATCTCTGAAGGCAACCAAACTGTGGAGGATATTGCAACCGGGCTCAACATTCCTGTCAACCAGGTGAACCCCAGATATGCCAAGGCGTGTGTGATCCATGGAACACACCTTAAGGACATGACATAATAGCACATTGATGACATCCTCACGCATCACACACACATCGTATTTGCCAGAACATCTCCTCATCAGAAGCTCATCATTGTGGAGGGTTGTCACCAACAGGGTGCGATTGTAGCAGTGACAGGTGATGGTGTAAATGACTCCCCTGCTCTGAAGAAAGAAGATATCAGTATCGCTATGGCCATCGCTGGTTCTGATGTCTCCAAGCAAGCAACCAACATGATCCTGTTGTATGATAACTTTGCTTCTATTGTTACTGAACTCGAGGAAGAGCAACAGATCTTTAATAACCTGAAGAAAACAATGGCCAACACCCTGACCAAGAACATCAATCAAATCACACCCTTCCTCGTCTCTCACATGGCCGACATTCTTCTCCCCTTGGGCAATGTGGGCATGCTAACTATCGGTCTTACCGAGAGGAGGACCCGGCGGGCTCCCTCCCTCCCGACGGACGGAAGGTTAACTGAGGAGGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGATACGGGGCCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838108
dbEST ID: 79655810
Trimmed Sequence: ATAATAGGATTCTTTTTCCACCCAGCCACCTGGGCTGCGCCTGATAATCAGCTTACGGACTTCATCATATATGAAGATGATCAGTGAGTATGGGAAGGCACAGAACCACCAGGTCGGTTTGAGCGGGTACATGCGCAGAGCAACATCCATTCCAGGACAGTAAGACAGGAAGGCCGCCGGTGCCGTCTCTTCAAACAGCCCAAAGATGAGGATTTTATTCTTCATTCCCTGCTGGAAGACGGAGTTCCTTCTGGTCTTACAGATGATCAGATCGGCCCACTGTACAACCACAATACTGATGAAGAAAGATGTATGGCACGTGAACTCCACAATCTTCCTCTGCTCGTAGGTCCACTGTTGTCCATAACTGTCTTCTACATCGTTTGTCCAACGGTCGTCCCAGTTCACTCTGATACCAAGCAGGGTCCAGGGCAGGAAGCCATTCTCAGCCAAGATAACAAAGTATGTGAAGAATCCCCCCAGGGCTTGGATCATACCGATCTGCCCATAGGCCATACTGATGAGTCTTTCATTCACCAGCTTGTCTGTTTTGGGATTTCGGGGCTGTCGCTTCATGATGTCACTCTCAGCTTGCTCATAAGCCAAGGAAATAGCAGGGAACCATGTCTGTGCCCAGAATCATACTTAAGAATGGTGACAGTGCCCCAGGGGCAAAGGAATGGTTGGCGAAGAATAAAAATTAAAGAAAGGT
Full Trace Sequence: GAGAAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATAATAGGATTCTTTTTCCACCCAGCCACCTGGGCTGCGCCTGATAATCAGCTTACGGACTTCATCATATATGAAGATGATCAGTGAGTATGGGAAGGCACAGAACCACCAGGTCGGTTTGAGCGGGTACATGCGCAGAGCAACATCCATTCCAGGACAGTAAGACAGGAAGGCCGCCGGTGCCGTCTCTTCAAACAGCCCAAAGATGAGGATTTTATTCTTCATTCCCTGCTGGAAGACGGAGTTCCTTCTGGTCTTACAGATGATCAGATCGGCCCACTGTACAACCACAATACTGATGAAGAAAGATGTATGGCACGTGAACTCCACAATCTTCCTCTGCTCGTAGGTCCACTGTTGTCCATAACTGTCTTCTACATCGTTTGTCCAACGGTCGTCCCAGTTCACTCTGATACCAAGCAGGGTCCAGGGCAGGAAGCCATTCTCAGCCAAGATAACAAAGTATGTGAAGAATCCCCCCAGGGCTTGGATCATACCGATCTGCCCATAGGCCATACTGATGAGTCTTTCATTCACCAGCTTGTCTGTTTTGGGATTTCGGGGCTGTCGCTTCATGATGTCACTCTCAGCTTGCTCATAAGCCAAGGAAATAGCAGGGAACCATGTCTGTGCCCAGAATCATACTTAAGAATGGTGACAGTGCCCCAGGGGCAAAGGAATGGTTGGCGAAGAATAAAAATTAAAGAAAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAATAGGATTCTTTTTCCACCCA