ORFeome > atp1a2 ORF1 – XORFeome v1.0

atp1a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp1a2
Gene ID: 6034797
Gene Page ID: 6034695
ORF Xenbase ID: 17265441

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060332
Original XGC clone length: 3063

Human orthology & disease relationships

NCBI Entrez ID: 477
Ensembl gene IDs: ENSG00000018625,LRG_6
Directly associated (OMIM) disease MIM numbers: 104290,602481
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11021
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ824772
dbEST ID: 79642474
Trimmed Sequence: ATGGGGAGAGGGGAGGGACGGGAGTATTCTCCCGCAGCAACCAACGCAGACAATGGAGGGGGCAAGAAGAAACAGAAAGAAAAGGAGATGGATGAGCTGAAGAAGGAAGTGGCCATGGATGATCACAAGCTCTCCTTGGAAGAGATTGGTCGAAAATATGGGACGGACCTTGCTAAGGGTTTGACAAATGCTCGTGCAGCAGAGATTCTGGCCCAAGATGGACCCAACTCCCTCACACCACCACCAACCACCCCAGAATGGGTAAAGTTTTGCAGGCAGCTCTTCGGCGGATTCTCCATTCTCCTGTGGATTGGAGCCATTCTGTGCTTTCTGGCCTATGGTATCCAGATTGCCATGGAGGATGAACCAGTCAATGACAATCTGTACCTTGGAGTGGTCTTAGCCGCTGTCGTCATTGTCACTGGCTGCTTCTCTTACTACCAAGAGGCAAAAAGTTCCAAGATCATGGATTCCTTCAAGAACATGGTGCCACAGCAAGCCTTGGTTATCCGTGAAGGAGAGAAGTTGCAGATAAATGCTGAGCAGGTGGTGGTCGGAGAGCTGGTGGAAATTAAAGGAGGAGATCGAATACCTGCAGACTTAAGAATAACTGTAGCTCATGGGTGCAAGGTGGATAATTCCTCTTTGACGGGAGAGTCTGAACCCCAAACTCGCTCTCCAGAAATCACCCACGAAAACCCACTTGAGACCAGAAACATTTGCTTTCTCTCTACCAACTGTGGTTGAAGGTACTGCCCAGAGGAATTGGTTATCGCTACAAGGAGACGGCACTGGTCATGGGGGCGTAATGGCCACCCCTAACCTTTCGGGGT
Full Trace Sequence: GCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAGAGGGGAGGGACGGGAGTATTCTCCCGCAGCAACCAACGCAGACAATGGAGGGGGCAAGAAGAAACAGAAAGAAAAGGAGATGGATGAGCTGAAGAAGGAAGTGGCCATGGATGATCACAAGCTCTCCTTGGAAGAGATTGGTCGAAAATATGGGACGGACCTTGCTAAGGGTTTGACAAATGCTCGTGCAGCAGAGATTCTGGCCCAAGATGGACCCAACTCCCTCACACCACCACCAACCACCCCAGAATGGGTAAAGTTTTGCAGGCAGCTCTTCGGCGGATTCTCCATTCTCCTGTGGATTGGAGCCATTCTGTGCTTTCTGGCCTATGGTATCCAGATTGCCATGGAGGATGAACCAGTCAATGACAATCTGTACCTTGGAGTGGTCTTAGCCGCTGTCGTCATTGTCACTGGCTGCTTCTCTTACTACCAAGAGGCAAAAAGTTCCAAGATCATGGATTCCTTCAAGAACATGGTGCCACAGCAAGCCTTGGTTATCCGTGAAGGAGAGAAGTTGCAGATAAATGCTGAGCAGGTGGTGGTCGGAGAGCTGGTGGAAATTAAAGGAGGAGATCGAATACCTGCAGACTTAAGAATAACTGTAGCTCATGGGTGCAAGGTGGATAATTCCTCTTTGACGGGAGAGTCTGAACCCCAAACTCGCTCTCCAGAAATCACCCACGAAAACCCACTTGAGACCAGAAACATTTGCTTTCTCTCTACCAACTGTGGTTGAAGGTACTGCCCAGAGGAATTGGTTATCGCTACAAGGAGACGGCACTGGTCATGGGGGCGTAATGGCCACCCCTAACCTTTCGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGAGGGGAGGG

Sequences - 3ʹ (reverse) EST

Accession: JZ830138
dbEST ID: 79647840
Trimmed Sequence: GTAGTAGCTCTCCTTCTCCACCCAACCGCCTGGATCACGTCTCAAGATCAGCTTCCTTACTTCATCATACAAAAATATCAGCAGGCTGTAGGGGAATGCACAGAACCACCAGGTCACCTTGAGAGGATACATTCTCAAAGCCACATCCATTCCAGGACAGTATGACAAGAATGCAGCCAGAGCCGTCTCTTCCAGAAGACCAAAGATGAGAATCTTATTCTTCATTCCTTGCTGGAACACAGAGTTTCTTCGGGTTTTACAGATGATTAGATCAGCCCATTGCACCACCACGATACTAGCAAAGAATGCGGTATGGCATGTGAACTCCACCACTTTGCGCTGTTCATAGGTCCACTCCTGCCCATAACTGTCTTCCACGTCATTTTTGGAACGATCATCCCAGTCCAAGCGGATTCCCAGCAAGGTGTAGGGCAGAAATCCATTCTCCGCCAGGATTACAAAGTAGGTGAAGAACCCACCCAAGGCCTGGATCATACCAATCTGCCCATAGGCCATGCTGATTAGACGTTCGTTCACCAGCTTGTCCGTCCGCGGGTTCCTTGGCTGCCTTTTCATAATGTCGCTCTCGGCTGCCTCATACGCTAGAGAGATGGCAGGCACCATGTCTGTTCCAGATCAATACAGAGGATGGTAACTGTCCCCAGTGGCAGCGAAATGTTGGCAATGATGAAAAAGGAAGAAAGGGGGTAATCTCAAGGGATGTTTGCCTGGTCAGTGGTTGTAAGCCAATTGGAACTTTCCTTTTAGGT
Full Trace Sequence: CGAGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGTAGCTCTCCTTCTCCACCCAACCGCCTGGATCACGTCTCAAGATCAGCTTCCTTACTTCATCATACAAAAATATCAGCAGGCTGTAGGGGAATGCACAGAACCACCAGGTCACCTTGAGAGGATACATTCTCAAAGCCACATCCATTCCAGGACAGTATGACAAGAATGCAGCCAGAGCCGTCTCTTCCAGAAGACCAAAGATGAGAATCTTATTCTTCATTCCTTGCTGGAACACAGAGTTTCTTCGGGTTTTACAGATGATTAGATCAGCCCATTGCACCACCACGATACTAGCAAAGAATGCGGTATGGCATGTGAACTCCACCACTTTGCGCTGTTCATAGGTCCACTCCTGCCCATAACTGTCTTCCACGTCATTTTTGGAACGATCATCCCAGTCCAAGCGGATTCCCAGCAAGGTGTAGGGCAGAAATCCATTCTCCGCCAGGATTACAAAGTAGGTGAAGAACCCACCCAAGGCCTGGATCATACCAATCTGCCCATAGGCCATGCTGATTAGACGTTCGTTCACCAGCTTGTCCGTCCGCGGGTTCCTTGGCTGCCTTTTCATAATGTCGCTCTCGGCTGCCTCATACGCTAGAGAGATGGCAGGCACCATGTCTGTTCCAGATCAATACAGAGGATGGTAACTGTCCCCAGTGGCAGCGAAATGTTGGCAATGATGAAAAAGGAAGAAAGGGGGTAATCTCAAGGGATGTTTGCCTGGTCAGTGGTTGTAAGCCAATTGGAACTTTCCTTTTAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGTAGCTCTCCTTCTCCA