ORFeome > atp1b1 ORF1 – XORFeome v1.0

atp1b1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp1b1
Gene ID: 864911
Gene Page ID: 482812
ORF Xenbase ID: 17265453

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047957
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID: 481
Ensembl gene IDs: ENSG00000143153
Directly associated (OMIM) disease MIM numbers: 145500
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11015
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ824214
dbEST ID: 79641916
Trimmed Sequence: ATGGCCAGGGACAAAGCTAAAGAAACCGATGGCGGCTGGAGGAAATTTATCTGGAATGCCGATAAGAAGGAATTTCTAGGCAGAACAGGTGGCAGCTGGTTTAAAATTTTATTGTTCTATCTCATCTTCTATGGGTGCCTTGCTGGTATATTTATTGGGACCATTCAAGTACTCCTGTTAACCATCAGCGAATTTGAACCAAAGTATCAAGATCGTGTTGCACCTCCAGGACTGACACAATTACCCAGAGCCGTAAAAACTGAAATCTCATTTTCACCGAGCGATTCTAATAGCTATCAGGAGTATGTGAAAAGCATGGATAACTTTCTTTCTAAGTACAACAATGAAAAACAAGGATCCAATATGTTTGAAGATTGTGGAACTATCCCTGGGCCATATCATGAGAGGGGAGCTCTCAACAAAGATGAAGGAATGAAAAAATCTTGTGTCTTCAGACGTGAATGGTTGCAGAACTGCTCTGGACTAAATGATCCTTCCTATGGATTTGCAGATGGCAAGCCATGCGTCATTGTGAAGCTTAACCGAATCTTGGCATTTAAGCCAGTGCCTCCACAGAATAACAGTCTTCCACCTGAAATGACATTGAACTACAACCCATACGTCATCCCTATCCACTGCCAGGCCAAGAAAGAAGAAGACATAGAAAANNATCAGGANGTGAAATATTATGGGAATGGGCGGATTTGCANGATTCCNACTGACGTACTATCCTTACTATGGAAAACTACTGCAGCCTGACTATCTACAGCCTCTTAATGGCTGTTGCAGTTTACCAATATCCCATTTTAAAAGCAAAAAATTCCTTTAAAAAAGGGCAC
Full Trace Sequence: AATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAGGGACAAAGCTAAAGAAACCGATGGCGGCTGGAGGAAATTTATCTGGAATGCCGATAAGAAGGAATTTCTAGGCAGAACAGGTGGCAGCTGGTTTAAAATTTTATTGTTCTATCTCATCTTCTATGGGTGCCTTGCTGGTATATTTATTGGGACCATTCAAGTACTCCTGTTAACCATCAGCGAATTTGAACCAAAGTATCAAGATCGTGTTGCACCTCCAGGACTGACACAATTACCCAGAGCCGTAAAAACTGAAATCTCATTTTCACCGAGCGATTCTAATAGCTATCAGGAGTATGTGAAAAGCATGGATAACTTTCTTTCTAAGTACAACAATGAAAAACAAGGATCCAATATGTTTGAAGATTGTGGAACTATCCCTGGGCCATATCATGAGAGGGGAGCTCTCAACAAAGATGAAGGAATGAAAAAATCTTGTGTCTTCAGACGTGAATGGTTGCAGAACTGCTCTGGACTAAATGATCCTTCCTATGGATTTGCAGATGGCAAGCCATGCGTCATTGTGAAGCTTAACCGAATCTTGGCATTTAAGCCAGTGCCTCCACAGAATAACAGTCTTCCACCTGAAATGACATTGAACTACAACCCATACGTCATCCCTATCCACTGCCAGGCCAAGAAAGAAGAAGACATAGAAAANNATCAGGANGTGAAATATTATGGGAATGGGCGGATTTGCANGATTCCNACTGACGTACTATCCTTACTATGGAAAACTACTGCAGCCTGACTATCTACAGCCTCTTAATGGCTGTTGCAGTTTACCAATATCCCATTTTAAAAGCAAAAAATTCCTTTAAAAAAGGGCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAGGGACAAAGCTAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829523
dbEST ID: 79647225
Trimmed Sequence: GCTACTCTTTATATCAAATTTGACATCAAAACGTCCCTGAAAGCGGTCTTTGTCATGATAATCTATATTTTCACCATAAGCCTTGCACTCTATACGGACTTCTGCATCAAATGTGATATTGGTAAACTGCACAGCAATAAGAGGCTGTAGATAGTCAGGCTGCAGTAGTTTTCCATAGTAAGGATAGTACGTCAGTGGGAATCCTGCAAATCCGCCCATTCCATAATATTTCACCTCCTTGATTTTTTCTATGTCTTCTTCTTTCTTGGCCTGGCAGTGGATAGGGATGACGTATGGGTTGTAGTTCAATGTCATTTCAGGTGGAAGACTGTTATTCTGTGGAGGCACTGGCTTAAATGCCAAGATTCGGTTAAGCTTCACAATGACGCATGGCTTGCCATCTGCAAATCCATAGGAAGGATCATTTAGTCCAGAGCAGTTCTGCAACCATTCACGTCTGAAGACACAAGATTTTTTCATTCCTTCATCTTTGTTGAGAGCTCCCCTCTCATGATATGGCCCAGGGATAGTTCCACAATCTTCAAACATATTGGATCCTTGTTTTTCATTGTTGTACTTAGAAAGAAAGTTATCCATGCTTTTCACATACTCCTGATAGCTATTAGAATCGCTCGGTGAAAATGAGATTTTCAGTTTTTACCGCCTCTGGGTAATTGTGTCCGGTCCTGGGAGGTGGCACAACAATCTTTGATAACTTTTGTTTCCAAATTTTGCCTAA
Full Trace Sequence: GGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTACTCTTTATATCAAATTTGACATCAAAACGTCCCTGAAAGCGGTCTTTGTCATGATAATCTATATTTTCACCATAAGCCTTGCACTCTATACGGACTTCTGCATCAAATGTGATATTGGTAAACTGCACAGCAATAAGAGGCTGTAGATAGTCAGGCTGCAGTAGTTTTCCATAGTAAGGATAGTACGTCAGTGGGAATCCTGCAAATCCGCCCATTCCATAATATTTCACCTCCTTGATTTTTTCTATGTCTTCTTCTTTCTTGGCCTGGCAGTGGATAGGGATGACGTATGGGTTGTAGTTCAATGTCATTTCAGGTGGAAGACTGTTATTCTGTGGAGGCACTGGCTTAAATGCCAAGATTCGGTTAAGCTTCACAATGACGCATGGCTTGCCATCTGCAAATCCATAGGAAGGATCATTTAGTCCAGAGCAGTTCTGCAACCATTCACGTCTGAAGACACAAGATTTTTTCATTCCTTCATCTTTGTTGAGAGCTCCCCTCTCATGATATGGCCCAGGGATAGTTCCACAATCTTCAAACATATTGGATCCTTGTTTTTCATTGTTGTACTTAGAAAGAAAGTTATCCATGCTTTTCACATACTCCTGATAGCTATTAGAATCGCTCGGTGAAAATGAGATTTTCAGTTTTTACCGCCTCTGGGTAATTGTGTCCGGTCCTGGGAGGTGGCACAACAATCTTTGATAACTTTTGTTTCCAAATTTTGCCTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTACTCTTTATATCAAATTTGAC