ORFeome > atp1b3 ORF1 – XORFeome v1.0

atp1b3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp1b3
Gene ID: 865516
Gene Page ID: 485126
ORF Xenbase ID: 17265477

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046716
Original XGC clone length: 834

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ823827
dbEST ID: 79641529
Trimmed Sequence: ATGGCCAAGGAAGAGAACAAGGGCAGCGAGCAGTCCGGCTCCGACTGGAAGCAGTTCATCTACAACCCGCAGAAAGGAGAGTTCATGGGCCGCACGGCTAGTAGTTGGGCCCTGATCTTGCTATTCTACTTGGTGTTTTATGGATTCCTCGCTGGGCTCTTTACCCTCACCATGTGGGTCATGCTTCAGACACTGGATGATTCTGTCCCCAAATACAGAGACAGAGTTTCTTCTCCAGGTTTAATGATTTCTCCTAAATCTGCTGGGCTTGAGATTAAATTCACCCAGAATAAGCCTCAGTCTTACATGGAATATGTGCAGGTTCTTAATACATTCCTTGCACCATACAATGATTCCCTACAGGCCAAAAATGAGCTTTGTGCCCCAGGCCTGTATTTCGATCAGGACAGAGAAGGTGAAAAGAAGTCGTGCCAGTTCAACAGGACATCACTGGGAATTTGCTCTGGGATAGAAGATCCCATGTTTGGATACGGCGAAGGCAAACCCTGTGTTATTGTCAAAATTAACAGGATTATTGGGTTGAAGCCAGAAGGAAACCCTAAGATAAACTGTACTTCTAAGACAGACGATGTGAGCCTGCAGTATTTTCCTGAAAACGGGAAGATAGACTTGATGTACTTCCCTTATTATGGGAAGAAAACCCATGTAAATTATGTTCAGCCTTTAGTCGCCGTCAAAATCTCTCCATCTAACTTCACCTCAGAGGAGATTTTCGGTCGAGTGCAAGAATCCACGGATCCGGCAACCCTTAAAACCAAGGACGAAGAGAGATTAGGTTTCCTGGGGGCA
Full Trace Sequence: AATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAAGGAAGAGAACAAGGGCAGCGAGCAGTCCGGCTCCGACTGGAAGCAGTTCATCTACAACCCGCAGAAAGGAGAGTTCATGGGCCGCACGGCTAGTAGTTGGGCCCTGATCTTGCTATTCTACTTGGTGTTTTATGGATTCCTCGCTGGGCTCTTTACCCTCACCATGTGGGTCATGCTTCAGACACTGGATGATTCTGTCCCCAAATACAGAGACAGAGTTTCTTCTCCAGGTTTAATGATTTCTCCTAAATCTGCTGGGCTTGAGATTAAATTCACCCAGAATAAGCCTCAGTCTTACATGGAATATGTGCAGGTTCTTAATACATTCCTTGCACCATACAATGATTCCCTACAGGCCAAAAATGAGCTTTGTGCCCCAGGCCTGTATTTCGATCAGGACAGAGAAGGTGAAAAGAAGTCGTGCCAGTTCAACAGGACATCACTGGGAATTTGCTCTGGGATAGAAGATCCCATGTTTGGATACGGCGAAGGCAAACCCTGTGTTATTGTCAAAATTAACAGGATTATTGGGTTGAAGCCAGAAGGAAACCCTAAGATAAACTGTACTTCTAAGACAGACGATGTGAGCCTGCAGTATTTTCCTGAAAACGGGAAGATAGACTTGATGTACTTCCCTTATTATGGGAAGAAAACCCATGTAAATTATGTTCAGCCTTTAGTCGCCGTCAAAATCTCTCCATCTAACTTCACCTCAGAGGAGATTTTCGGTCGAGTGCAAGAATCCACGGATCCGGCAACCCTTAAAACCAAGGACGAAGAGAGATTAGGTTTCCTGGGGGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAAGGAAGAGAACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829135
dbEST ID: 79646837
Trimmed Sequence: CTCGCTGATCTTCACTTTGAATGTCACTCGCCCCAGGAACTTATCTCTCTCGTCCTCGTTCTTAAGGTTGCGGGATCCGTGGATCTTGCACTCGACCGAAATCTCCTCTGAGGTGAAGTTAGATGGAGAGATTTTGACGGCGACTAAAGGCTGAACATAATTTACATGGGTTTTCTTCCCATAATAAGGGAAGTACATCAAGTCTATCTTCCCGTTTTCAGGAAAATACTGCAGGCTCACATCGTCTGTCTTAGAAGTACAGTTTATCTTAGGGTTTCCTTCTGGCTTCAACCCAATAATCCTGTTAATTTTGACAATAACACAGGGTTTGCCTTCGCCGTATCCAAACATGGGATCTTCTATCCCAGAGCAAATTCCCAGTGATGTCCTGTTGAACTGGCACGACTTCTTTTCACCTTCTCTGTCCTGATCGAAATACAGGCCTGGGGCACAAAGCTCATTTTTGGCCTGTAGGGAATCATTGTATGGTGCAAGGAATGTATTAAGAACCTGCACATATTCCATGTAAGACTGAGGCTTATTCTGGGTGAATTTAATCTCAAGCCCAGCAGATTTAGGAGAAATCATTAAACCTGGAGAAGAAACTCTGTCTCTGTATTTGGGGACAGAATCATCCAGTGTCTGAAGCATGACCCACATGGTGAGGGTAAAGAGCCCAGCGAGGAATCCATAAACACCCAATTAGAATAGCCAGAACAAGGGCCCAACTACCTAGCCGTGGCGGCCCCAGGAACTTCCCCCTTTTTCGTC
Full Trace Sequence: CCGTGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGCTGATCTTCACTTTGAATGTCACTCGCCCCAGGAACTTATCTCTCTCGTCCTCGTTCTTAAGGTTGCGGGATCCGTGGATCTTGCACTCGACCGAAATCTCCTCTGAGGTGAAGTTAGATGGAGAGATTTTGACGGCGACTAAAGGCTGAACATAATTTACATGGGTTTTCTTCCCATAATAAGGGAAGTACATCAAGTCTATCTTCCCGTTTTCAGGAAAATACTGCAGGCTCACATCGTCTGTCTTAGAAGTACAGTTTATCTTAGGGTTTCCTTCTGGCTTCAACCCAATAATCCTGTTAATTTTGACAATAACACAGGGTTTGCCTTCGCCGTATCCAAACATGGGATCTTCTATCCCAGAGCAAATTCCCAGTGATGTCCTGTTGAACTGGCACGACTTCTTTTCACCTTCTCTGTCCTGATCGAAATACAGGCCTGGGGCACAAAGCTCATTTTTGGCCTGTAGGGAATCATTGTATGGTGCAAGGAATGTATTAAGAACCTGCACATATTCCATGTAAGACTGAGGCTTATTCTGGGTGAATTTAATCTCAAGCCCAGCAGATTTAGGAGAAATCATTAAACCTGGAGAAGAAACTCTGTCTCTGTATTTGGGGACAGAATCATCCAGTGTCTGAAGCATGACCCACATGGTGAGGGTAAAGAGCCCAGCGAGGAATCCATAAACACCCAATTAGAATAGCCAGAACAAGGGCCCAACTACCTAGCCGTGGCGGCCCCAGGAACTTCCCCCTTTTTCGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGCTGATCTTCACTTTGAAT