ORFeome > atp4b ORF1 – XORFeome v1.0

atp4b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: atp4b
Gene ID: 944896
Gene Page ID: 944890
ORF Xenbase ID: 17265507

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054193
Original XGC clone length: 888

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ839178
dbEST ID: 79656880
Trimmed Sequence: ATGGCAACTTTCAATGAAAAAAAGACTTGCAGCCAACGCATGGAAAACTTTGGACGTTTTGTGTGGAACCCAGATACTTCGGAGTTTATGGGAAGAACATTTGCCAAGTGGGTGTACATCAGTCTTTACTATGCCGCATTCTACGTTATTATGGTTGGAATCTTTGCACTGTCTATATATTCCCTGATGCAAACTCTGAGCCCGTATGTTCCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACATTGAGACCAGATCCATATGGAGATGAAGTAATTGAACTCTTTTACAACATGGCTGACAACAAAACATACCTCCCACTTGTAACCAGTCTGTGTGAGTTTCTCCCGGTGTACAACAAATCAGTTCAAGAAAAGATGAACGCAAACTGCTCTGACCATACAAGAATCTCTTGTGCTCATCAGAATGAGAATACGAAGTCCTGCCAGTTTACTACAGATATGCTGGGAAATTGCTCTTGGGAACATGATCACACATTTGGCTACAAATCTGGAAAACCTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCCTCTTGTGAACTGTTCAGCTGAGAATGGAAAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAGATGCAGCCAAATTACACCAATCCTTTGGTAACGGTGGAAATTCTTAAACCCAACCTGAAACAAAGAA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACTTTCAATGAAAAAAAGACTTGCAGCCAACGCATGGAAAACTTTGGACGTTTTGTGTGGAACCCAGATACTTCGGAGTTTATGGGAAGAACATTTGCCAAGTGGGTGTACATCAGTCTTTACTATGCCGCATTCTACGTTATTATGGTTGGAATCTTTGCACTGTCTATATATTCCCTGATGCAAACTCTGAGCCCGTATGTTCCAGATTATCAGGATGAACTGAAATCGCCAGGTGTGACATTGAGACCAGATCCATATGGAGATGAAGTAATTGAACTCTTTTACAACATGGCTGACAACAAAACATACCTCCCACTTGTAACCAGTCTGTGTGAGTTTCTCCCGGTGTACAACAAATCAGTTCAAGAAAAGATGAACGCAAACTGCTCTGACCATACAAGAATCTCTTGTGCTCATCAGAATGAGAATACGAAGTCCTGCCAGTTTACTACAGATATGCTGGGAAATTGCTCTTGGGAACATGATCACACATTTGGCTACAAATCTGGAAAACCTTGTCTTTTTATAAAGATGAACAGGATAATAAATTTTGTTCCAGGCAACAAGACTGCTCCTCTTGTGAACTGTTCAGCTGAGAATGGAAAACTTGGCGATGTACAGTATTATCCAGGCAATGACACATATGGGGACTATTGGTCTTCAGTACTTCCCATATTGTGGAAAGAAGATGCAGCCAAATTACACCAATCCTTTGGTAACGGTGGAAATTCTTAAACCCAACCTGAAACAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACTTTCAATGAAAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839177
dbEST ID: 79656879
Trimmed Sequence: ATTTGCACTAGATGAAAGAGGTTTATTTTCTATCTTAAGTTTGAATGATACTTTTCCTTCATAGGGATCATGTGGGTTGTCCGAGGTGATGCCATGTCCAGAAACTTTACAGACTACACTCAGTTCTTTGTTCAGTGTCGGATTAAGTAATTTCACCGCTACCAAAGGATTGGTGTAATTTGGCTGCATTTTCTTTCCACAATATGGGAAGTACTGAAGACCAATAGTCCCATATGTGTCATTGCCTGGATAATACTGTACATCGCCAAGTTCTCCATTCTCAGCTGAACAGTTCACAAGAGGAGCAGTCTTGTTGCCTGGAACAAAATTTATTATCCTGTTCATCTTTATAAAAAGACAAGGTTTTCCAGATTTGTAGCCAAATGTGTGATCATGTTCCCAAGAGCAATTTCCCAGCATATCTGTAGTAAACTGGCAGGACTTCGTATTCTCATTCTGATGAGCACAAGAGATTCTTGTATGGTCAGAGCAGTTTGCGTTCATCTTTTCTTGAACTGATTTGTTGTACACCGGGAGAAACTCACACAGACTGGTTACAAGTGGGAGGTATGTTTTGTTGTCAGCCATGTTGTAAAAGAGTTCAATTACTTCATTCTCCTATGGATCTGGTTCTCATGGTCCACCGGGCAATTTCCTTTCATCCTGGAAATCCTGGAAACATACGGGGCTCAAAATTTTGCATCAGGGGAATATATAGAAAGGGGCAAAAAATTCCCAACCAATA
Full Trace Sequence: GCGTGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTGCACTAGATGAAAGAGGTTTATTTTCTATCTTAAGTTTGAATGATACTTTTCCTTCATAGGGATCATGTGGGTTGTCCGAGGTGATGCCATGTCCAGAAACTTTACAGACTACACTCAGTTCTTTGTTCAGTGTCGGATTAAGTAATTTCACCGCTACCAAAGGATTGGTGTAATTTGGCTGCATTTTCTTTCCACAATATGGGAAGTACTGAAGACCAATAGTCCCATATGTGTCATTGCCTGGATAATACTGTACATCGCCAAGTTCTCCATTCTCAGCTGAACAGTTCACAAGAGGAGCAGTCTTGTTGCCTGGAACAAAATTTATTATCCTGTTCATCTTTATAAAAAGACAAGGTTTTCCAGATTTGTAGCCAAATGTGTGATCATGTTCCCAAGAGCAATTTCCCAGCATATCTGTAGTAAACTGGCAGGACTTCGTATTCTCATTCTGATGAGCACAAGAGATTCTTGTATGGTCAGAGCAGTTTGCGTTCATCTTTTCTTGAACTGATTTGTTGTACACCGGGAGAAACTCACACAGACTGGTTACAAGTGGGAGGTATGTTTTGTTGTCAGCCATGTTGTAAAAGAGTTCAATTACTTCATTCTCCTATGGATCTGGTTCTCATGGTCCACCGGGCAATTTCCTTTCATCCTGGAAATCCTGGAAACATACGGGGCTCAAAATTTTGCATCAGGGGAATATATAGAAAGGGGCAAAAAATTCCCAACCAATA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTGCACTAGATGAAAGAGGTTT