ORFeome > atp5a1 ORF1 – XORFeome v1.0

atp5a1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6256585
Gene Page ID:
ORF Xenbase ID: 17265513

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054959
Original XGC clone length: 1662

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ839411
dbEST ID: 79657113
Trimmed Sequence: ATGCTGTCAGTCCGTGTAGCCGCCGCGCTGGCCCGCGCTCTGCCTCGTCAGTCCGGCCTGGTGTCCAAGAAAGCCCTCGGTGCTGCATTTGTTGCCACCAGGAACATTCATGCATCTGGCGCATGGCTTCAGAAGTCTGGCACCGCAGAAGTGTCCTCTATCCTGGAAGAGAGAATCCTTGGTGCCGACATCAGCACCGACCTAGAGGAGACTGGCCGGGTCCTTTCCATTGGTGATGGTATCGCTCGTGTCTATGGGCTTAGGAATGTCCAGGCAGAAGAGATGGTGGAATTCTCGTCTGGCCTGAAGGGCATGTCGTTGAACTTGGAGCCTGACAATGTTGGTGGTGGTGGTGTTTGGTAACGACAAGCTGATTAAGGAAGGCGACATTGTGAAGAGGACAGGAGCCATTGTGGATGTGCCCGTGGGTGATGAGCTGCTGGGTCGTGTTGTTGATGCTCTGGGTAACGCTATTGATGGCAAGGGCCCCCTTACATCAAAAATCCGCAGAAGAGTGGGTCTGAAGGCCCCAGGTATCATTCCCCGTATCTCTGTGAGGGAACCCATGCAGACTGGCATTAAAGCTGTTGACAGTTTGGTGTCCATTGGCCGTGGTCAGCGTGAGCTCATCATCGGTGACAGACAGACTGCCAAAACCCTCCATTGCCATCGATACGATTATCAACCAGAAAAGATTCAACGAAGGAAACTGATTAAAAAAAAAAAACTGTACTGTATCCTATGTTGCCCTTTGTTCAAAAAAAATCCAGTGGGGGCTCAACCTGGTCAAAGAAAACTAAACCGAAAGCAAAAATGCCA
Full Trace Sequence: GCGGGCCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTCAGTCCGTGTAGCCGCCGCGCTGGCCCGCGCTCTGCCTCGTCAGTCCGGCCTGGTGTCCAAGAAAGCCCTCGGTGCTGCATTTGTTGCCACCAGGAACATTCATGCATCTGGCGCATGGCTTCAGAAGTCTGGCACCGCAGAAGTGTCCTCTATCCTGGAAGAGAGAATCCTTGGTGCCGACATCAGCACCGACCTAGAGGAGACTGGCCGGGTCCTTTCCATTGGTGATGGTATCGCTCGTGTCTATGGGCTTAGGAATGTCCAGGCAGAAGAGATGGTGGAATTCTCGTCTGGCCTGAAGGGCATGTCGTTGAACTTGGAGCCTGACAATGTTGGTGGTGGTGGTGTTTGGTAACGACAAGCTGATTAAGGAAGGCGACATTGTGAAGAGGACAGGAGCCATTGTGGATGTGCCCGTGGGTGATGAGCTGCTGGGTCGTGTTGTTGATGCTCTGGGTAACGCTATTGATGGCAAGGGCCCCCTTACATCAAAAATCCGCAGAAGAGTGGGTCTGAAGGCCCCAGGTATCATTCCCCGTATCTCTGTGAGGGAACCCATGCAGACTGGCATTAAAGCTGTTGACAGTTTGGTGTCCATTGGCCGTGGTCAGCGTGAGCTCATCATCGGTGACAGACAGACTGCCAAAACCCTCCATTGCCATCGATACGATTATCAACCAGAAAAGATTCAACGAAGGAAACTGATTAAAAAAAAAAAACTGTACTGTATCCTATGTTGCCCTTTGTTCAAAAAAAATCCAGTGGGGGCTCAACCTGGTCAAAGAAAACTAAACCGAAAGCAAAAATGCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTCAGTCCGTGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839410
dbEST ID: 79657112
Trimmed Sequence: TGCTTCGAATGTGGACAGGAAGTTCAGAACGATTTCTTTGAGTTTGGCATCGGCCTGTTCAGAGATCTTGCCATCAGTCCTGATTGTAGCAAGAAGCTCCTGGTGTTGGCTCTTAACGTGAGCAAGGAAAGCGCTCTCAAACTTGGTGATTTTGCTGGGCTCCATCTTGTCAAGATGTCCCCTGACACCGGCATAGATTACTGTTACCTGTTCTTCAATGGCCATGGGAACGTATTGCCCTTGCTTCAGCAACTCAGTCAGACGCACGCCACGGTTCAGGAGTTGTTGTGTAGCCGCATCTAAATCAGAGCCGAATTGAGCAAAAGCAGCAACTTCACGGTACTGAGCCAACTCCAGCTTCATAGTACCGGCCACCTGTTTCATAGCTCTGGTCTGAGCAGCTGATCCCACTCTGGACACAGACAGACCTACGTTGATAGCAGGACGGATACCCTTGTAGAACAACTCTGTCTCCAAGAAAATCTGTCCATCAGTGATGGAGATGACATTGGTTGGGATGTAAGCGGACACATCACCCGCCTGTGTTTNCATGACAGGGAGAGCAGTCAGGGAGCCGCCTCCAAAATGATCGTTCATTTTCGCTGCTCTTTCCAGAAGACGGGAGTGAAGATAAAAGACATCCCCGGGGGTAGGCTCACGACCAGGAGGACGACGCAACAACAAAAACCTCTGAAGGGTGGGCTACAGCCCTGCCTGGAACAATTCATTCATAAAATGGAACCAAAAG
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTTCGAATGTGGACAGGAAGTTCAGAACGATTTCTTTGAGTTTGGCATCGGCCTGTTCAGAGATCTTGCCATCAGTCCTGATTGTAGCAAGAAGCTCCTGGTGTTGGCTCTTAACGTGAGCAAGGAAAGCGCTCTCAAACTTGGTGATTTTGCTGGGCTCCATCTTGTCAAGATGTCCCCTGACACCGGCATAGATTACTGTTACCTGTTCTTCAATGGCCATGGGAACGTATTGCCCTTGCTTCAGCAACTCAGTCAGACGCACGCCACGGTTCAGGAGTTGTTGTGTAGCCGCATCTAAATCAGAGCCGAATTGAGCAAAAGCAGCAACTTCACGGTACTGAGCCAACTCCAGCTTCATAGTACCGGCCACCTGTTTCATAGCTCTGGTCTGAGCAGCTGATCCCACTCTGGACACAGACAGACCTACGTTGATAGCAGGACGGATACCCTTGTAGAACAACTCTGTCTCCAAGAAAATCTGTCCATCAGTGATGGAGATGACATTGGTTGGGATGTAAGCGGACACATCACCCGCCTGTGTTTNCATGACAGGGAGAGCAGTCAGGGAGCCGCCTCCAAAATGATCGTTCATTTTCGCTGCTCTTTCCAGAAGACGGGAGTGAAGATAAAAGACATCCCCGGGGGTAGGCTCACGACCAGGAGGACGACGCAACAACAAAAACCTCTGAAGGGTGGGCTACAGCCCTGCCTGGAACAATTCATTCATAAAATGGAACCAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTCGAATGTGGACAGG