ORFeome > atp5d ORF1 – XORFeome v1.0

atp5d ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: atp5d
Gene ID: 978395
Gene Page ID: 978388
ORF Xenbase ID: 17265543

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078510
Original XGC clone length: 489

Human orthology & disease relationships

NCBI Entrez ID: 513
Ensembl gene IDs: ENSG00000099624
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,500003,551500,609283

Library Location

Plate ID: GDExl11005
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ839798
dbEST ID: 79657500
Trimmed Sequence: ATGCTGTCTGCCCGTGCTCTCTTTGCTCTCCGCCGGGCTGTATTTAGCCAGGTTCGGACATATGCCGAAGCAGCTCCCGCGGGGGCTCCCGCCATGAGCTTCACGTTCGCTTCCTCGACTCAGGTTTTCTACAGTGGTGCCAGTGTGAAACAGGTTGATGTACCCACATTGACAGGAATGTTTGGCATTCTCCCAGCCCATGTCCCAACTCTACAAGTTCTCAGGCCAGGCCTTGTAACGGTGTTCAGTGATGATGGTGTTGCAACTAAATATTTTGTGAGCAGTGGTTCAGTAACGGTGAATGCAGACTCTTCTGTGCAGCTCCTGGCTGAAGAGGCAGTGACACTGGACATGTTAGACCTTAGTACTGCAAAGTCAAACTTGGAAAAGGCACAGGCAGAGCTACAAAGTGCTGGAGATGAAGCGGCAAAAGCAGAGGCTCTAATTAATGTTGAAGCTAGTGAGGCTATTGTCAAAGCCCTGGAATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTCTGCCCGTGCTCTCTTTGCTCTCCGCCGGGCTGTATTTAGCCAGGTTCGGACATATGCCGAAGCAGCTCCCGCGGGGGCTCCCGCCATGAGCTTCACGTTCGCTTCCTCGACTCAGGTTTTCTACAGTGGTGCCAGTGTGAAACAGGTTGATGTACCCACATTGACAGGAATGTTTGGCATTCTCCCAGCCCATGTCCCAACTCTACAAGTTCTCAGGCCAGGCCTTGTAACGGTGTTCAGTGATGATGGTGTTGCAACTAAATATTTTGTGAGCAGTGGTTCAGTAACGGTGAATGCAGACTCTTCTGTGCAGCTCCTGGCTGAAGAGGCAGTGACACTGGACATGTTAGACCTTAGTACTGCAAAGTCAAACTTGGAAAAGGCACAGGCAGAGCTACAAAGTGCTGGAGATGAAGCGGCAAAAGCAGAGGCTCTAATTAATGTTGAAGCTAGTGAGGCTATTGTCAAAGCCCTGGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCCTATAGGGTGGTCATAGCCGTTTTCCTGAGAAAAAAAAAAAGTGTTCAAACAAAAAAAAAAAAAAAAAAACAGCTCCTCTGAAAAATAGATCGGTGCCCCCTTTCCCTTACACCCCCTTTTTTTTTTGGGTTTTTTACCCTCGTTGAAACCCCCCCCCAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGATTATATATTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTCTGCCCGTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839797
dbEST ID: 79657499
Trimmed Sequence: TTCCAGGGCTTTGACAATAGCCTCACTAGCTTCAACATTAATTAGAGCCTCTGCTTTTGCCGCTTCATCTCCAGCACTTTGTAGCTCTGCCTGTGCCTTTTCCAAGTTTGACTTTGCAGTACTAAGGTCTAACATGTCCAGTGTCACTGCCTCTTCAGCCAGGAGCTGCACAGAAGAGTCTGCATTCACCGTTACTGAACCACTGCTCACAAAATATTTAGTTGCAACACCATCATCACTGAACACCGTTACAAGGCCTGGCCTGAGAACTTGTAGAGTTGGGACATGGGCTGGGAGAATGCCAAACATTCCTGTCAATGTGGGTACATCAACCTGTTTCACACTGGCACCACTGTAGAAAACCTGAGTCGAGGAAGCGAACGTGAAGCTCATGGCGGGAGCCCCCGCGGGAGCTGCTTCGGCATATGTCCGAACCTGGCTAAATACAGCCCGGCGGAGAGCAAAGAGAGCACGGGCAGACAGCATGG
Full Trace Sequence: GAGCAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCAGGGCTTTGACAATAGCCTCACTAGCTTCAACATTAATTAGAGCCTCTGCTTTTGCCGCTTCATCTCCAGCACTTTGTAGCTCTGCCTGTGCCTTTTCCAAGTTTGACTTTGCAGTACTAAGGTCTAACATGTCCAGTGTCACTGCCTCTTCAGCCAGGAGCTGCACAGAAGAGTCTGCATTCACCGTTACTGAACCACTGCTCACAAAATATTTAGTTGCAACACCATCATCACTGAACACCGTTACAAGGCCTGGCCTGAGAACTTGTAGAGTTGGGACATGGGCTGGGAGAATGCCAAACATTCCTGTCAATGTGGGTACATCAACCTGTTTCACACTGGCACCACTGTAGAAAACCTGAGTCGAGGAAGCGAACGTGAAGCTCATGGCGGGAGCCCCCGCGGGAGCTGCTTCGGCATATGTCCGAACCTGGCTAAATACAGCCCGGCGGAGAGCAAAGAGAGCACGGGCAGACAGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTAAAAACTGGCCGTCGATTAAGACAAAATAGACACATGGGAGTTTTCTTGGCAGCTCTGGCCCGTTTTTTCAATATCTGTGAGTTTTAAAAGTGGTGTNGTGGGGGAGAGACGCCGGGGGGGGNCCCNACGCCAAAAAACAAAAGAAAATAATAACCAATCATAGCCCGACAGGGTGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCAGGGCTTTGACAATAG