ORFeome > atp5j2 ORF1 – XORFeome v1.0

atp5j2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: atp5j2
Gene ID: 963451
Gene Page ID: 963445
ORF Xenbase ID: 17265579

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC078621
Original XGC clone length: 258

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ839828
dbEST ID: 79657530
Trimmed Sequence: ATGGTGCCCATAGCAGAGCGAAGGCTCATGGATGTTAAGCTTGGTCAGCTGCCCAGCTGGCTATCCACACGTGATTTCGCTCCAAATGGAATCATCGCATCCTTACGCAGAGGCCATAGCTCCTATTACAACAAGTACATCAATGTGAAGAAGGGAGGCATTGGAGGAGTGGCTATGCTCCTGGCTGGTTATGTTATTCTGAGTTATGTCTCGGAATATGATCACATCAAGCATGATCGCTGGAGAAAGTATCACTT
Full Trace Sequence: TCGGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCCCATAGCAGAGCGAAGGCTCATGGATGTTAAGCTTGGTCAGCTGCCCAGCTGGCTATCCACACGTGATTTCGCTCCAAATGGAATCATCGCATCCTTACGCAGAGGCCATAGCTCCTATTACAACAAGTACATCAATGTGAAGAAGGGAGGCATTGGAGGAGTGGCTATGCTCCTGGCTGGTTATGTTATTCTGAGTTATGTCTCGGAATATGATCACATCAAGCATGATCGCTGGAGAAAGTATCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCATCTCTGGGATTAAAAACAAAAAAAAAAAAATCAAAGATAGGGACAGCCACGCAGCAAAAAAAAAAAAAAGTAATGGTACCCAGGGCCCTTGGTGAATCTCTCCTGGACAGGGAAAAAGGCCCAAACACAGAAAACAAACGGGTCGGGTGTTAACTTTATATAAAAAAACCAGGAGGACCCCCCCCGGCCCAAAACTTTACCAAAGGGTGGGGGGTAAGGGGGGGGGGGGGGGGTTGGGGGTTTTTTTAGTTTTTTTTTGGGGGTTTTATAAAACCTCCCCACACAAAAAAAGCGGGGGGGCCCCCGGGGGGGATTGTTGGTTTTTTTTTTTGTTGAAATTTTTTTTTATAAAGTTGTTTTTTTTTCTTGAGGCAAAAAAAAAATTTTTTATCCGCGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCCCATAGCAGAGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839827
dbEST ID: 79657529
Trimmed Sequence: GTGATACTTTCTCCAGCGATCATGCTTGATGTGATCATATTCCGAGACATAACTCAGAATAACATAACCAGCCAGGAGCATAGCCACTCCTCCAATGCCTCCCTTCTTCACATTGATGTACTTGTTGTAATAGGAGCTATGGCCTCTGCGTAAGGATGCGATGATTCCATTTGGAGCGAAATCACGTGTGGATAGCCAGCTGGGCAGCTGACCAAGCTTAACATCCATGAGCCTTCGCTCTGCTATGGGCACCATGG
Full Trace Sequence: CCGGGAAATCGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGATACTTTCTCCAGCGATCATGCTTGATGTGATCATATTCCGAGACATAACTCAGAATAACATAACCAGCCAGGAGCATAGCCACTCCTCCAATGCCTCCCTTCTTCACATTGATGTACTTGTTGTAATAGGAGCTATGGCCTCTGCGTAAGGATGCGATGATTCCATTTGGAGCGAAATCACGTGTGGATAGCCAGCTGGGCAGCTGACCAAGCTTAACATCCATGAGCCTTCGCTCTGCTATGGGCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGAACGTCGATTTACACATCTTGACTGGGCTAAGGCACGGCAGGGCGGAAACAAACAAAAGGTCACTAGTGCCCCAGGTCCTGGTTGCCTTTTTGGTGTATACGGAAAACGGAGGAACCAAAAAAAAAAGGGGGAACGCTTTATACGTTGTTTTATAAGGGGGAGAGGCGCCGCCCGGACAAAACATACCCACCCTGGGGGGTTCTGGGCAGGTGGGGGTCATGGGCGTTATAGGGGTTTTTGGGGGTTTTTTGGCTGGGTCTTCTAACCCGGGCCGCCCCCCCCGCGGCCTTTTTCCCGTTTTGTGGGGTCTTGGTTTGGTGGGGTGGGGTGTTCCCCCTTATCAACTGCCACTTCTTATGAGGAGGAGGGGGGCGCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGATACTTTCTCCAGCGAT