ORFeome > atp5l ORF1 – XORFeome v1.0

atp5l ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: atp5l
Gene ID: 923065
Gene Page ID: 923056
ORF Xenbase ID: 17265585

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078473
Original XGC clone length: 324

Human orthology & disease relationships

NCBI Entrez ID: 10632
Ensembl gene IDs: ENSG00000167283
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,500003,551500,609283

Library Location

Plate ID: GDExl11004
Well Location: D11

Sequences - 5ʹ (forward) EST

Accession: JZ839786
dbEST ID: 79657488
Trimmed Sequence: ATGGCTCAGGCAGCTCAGAGGCTTGTAAAGGCCGTAACCACAAAGACTCCTCAGCTTGTTGGCGCTGCTGTTGGTTACTCCCGTCCACGACTTGCTACTTTTTGGTACTATGCCAGAGTTGAGCTCGCCCCTCCAAGTCCTGCAGAGATCCCAAAAGCCATTGAGAGCATAAAGGGTCTGGCCAAGTCTTTTCAAAGAGGCCGCTTGTCTGAGCTCACTGTCCGGGAGACCCTGCGAAATGGTCTGGTAGCTATAGAGGTCCTTATGTGGTTTTATATTGGGGAGTGCATCGGAAAAGGTGGCCTTGTGGGATACAATGTTTT
Full Trace Sequence: GGGGGTCTTGGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCAGGCAGCTCAGAGGCTTGTAAAGGCCGTAACCACAAAGACTCCTCAGCTTGTTGGCGCTGCTGTTGGTTACTCCCGTCCACGACTTGCTACTTTTTGGTACTATGCCAGAGTTGAGCTCGCCCCTCCAAGTCCTGCAGAGATCCCAAAAGCCATTGAGAGCATAAAGGGTCTGGCCAAGTCTTTTCAAAGAGGCCGCTTGTCTGAGCTCACTGTCCGGGAGACCCTGCGAAATGGTCTGGTAGCTATAGAGGTCCTTATGTGGTTTTATATTGGGGAGTGCATCGGAAAAGGTGGCCTTGTGGGATACAATGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAAAATCACAATCAAAAAAGTTAAATTAAAAGCTCTCTCCACCCCCCGGAAAAAAAAAAAGCAAATAAAAAAAAACAAACGTTTCCGGTGTTTCTCTTTTGGGAAAAAAATAAAAGAGAGAAGGCAATCACCAAGACCGTTTTGTGTGTTGGGGTAACAGCAGCCGGGGAGGGGCCTCCCACCGGGCCAAAACATTTTAGAAAAACCCGGGGGGACGGGGACAGGGGGGTTTTTTGGGGGTGTTTAAATTTTTTTTTTGGGAAATCATTTTTTGCCCCCAACCCCCCAAAACCAACAAACCCCACCCCCGGGGGGGGAGGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCAGGCAGCTCAGAGG

Sequences - 3ʹ (reverse) EST

Accession: JZ839785
dbEST ID: 79657487
Trimmed Sequence: AACATTGTATCCCACAAGGCCACCTTTTCCGATGCACTCCCCAATATAAAACCACATAAGGACCTCTATAGCTACCAGACCATTTCGCAGGGTCTCCCGGACAGTGAGCTCAGACAAGCGGCCTCTTTGAAAAGACTTGGCCAGACCCTTTATGCTCTCAATGGCTTTTGGGATCTCTGCAGGACTTGGAGGGGCGAGCTCAACTCTGGCATAGTACCAAAAAGTAGCAAGTCGTGGACGGGAGTAACCAACAGCAGCGCCCACAAGCTGAGGAGTCTTTGTGGTTACGGCCTTTACAAGCCTCTGAGCTGCCTGAGCCATGG
Full Trace Sequence: AAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACATTGTATCCCACAAGGCCACCTTTTCCGATGCACTCCCCAATATAAAACCACATAAGGACCTCTATAGCTACCAGACCATTTCGCAGGGTCTCCCGGACAGTGAGCTCAGACAAGCGGCCTCTTTGAAAAGACTTGGCCAGACCCTTTATGCTCTCAATGGCTTTTGGGATCTCTGCAGGACTTGGAGGGGCGAGCTCAACTCTGGCATAGTACCAAAAAGTAGCAAGTCGTGGACGGGAGTAACCAACAGCAGCGCCCACAAGCTGAGGAGTCTTTGTGGTTACGGCCTTTACAAGCCTCTGAGCTGCCTGAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAACCTTAATACTAAAAATCAAATTAAACTATTAAAAAAGAAGAGGGAACTGCCCGCCCCCGAAAAAAATAAAGAAAAACCCAGCAACGAGGGTTCCGTGTGGAGTTTTCTGGGGAGAAAGGACGGGAAAAACCAAGAAACACAGCGAGGGTCGGTAAGTTGTGGATAGAATCTTCTAGTGGCCTTCCCCACCGGGGCAAAACTTTGCAAAACAAAGGGGGGAAAGGCGCGGGTGGGGGTTTGGGTGTTTGTTTATTGGTTTTTCGGGTTGCCCCTTTTCCCCCCGGATTTCNACACAACCAACCGCGTTACCCCGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACATTGTATCCCACAAGGC