ORFeome > atp6v0a1 ORF1 – XORFeome v1.0

atp6v0a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp6v0a1
Gene ID: 959351
Gene Page ID: 959345
ORF Xenbase ID: 17265621

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041732
Original XGC clone length: 2496

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ823651
dbEST ID: 79641353
Trimmed Sequence: ATGGGGGAACTCTTCCGAAGTGAGGAGATGACCTTGGCCCAGCTTTTCCTTCAGTCTGAAGCTGCTTATTGCTGTGTTAGTGAACTGGGAGAGCTGGGGAAAGTCCAGTTTAGAGATTTAAATCCAGATGTCAATGTATTCCAGAGGAAATTTGTCAATGAGGTCCGAAGATGCGAAGAAATGGACCGTAAACTGCGGTTTGTGGAAAAGGAGGTGAAGAAAGCAAATATTTCAATCCTTGACACTGGCGAGAACCCAGAAGTCCCCTTTCCTAGGGACATTATTGACCTTGAGGCAAATTTTGAAAAGATTGAGATTGAACTGAAAGAAATAAACACAAACCAAGAGGCTTTGAAGAGGAACTTCCTTGAACTGACGGAGTTAAAATTCATTCTGCGCAAAACCCAGCAATTTTTTGATGAGATGGCGGATCCGGATCTTTTGGAAGAATCCTCCACATTGCTGGAGCCCAGTGAGATGGGAAGAGGAGCGCCCTTAAGACTTGGCTTTGTGGCTGGAGTGATTAATCGTGAGAGGATCCCAACCTTCGAGAGGATGCTGTGGCGTGTTTGTCGTGGAAATGTCTTCTTGCGTCAGGCACAGATTGAAAACCCATTGGAGGATCCCGTTACGGGTGACAGTGTTCACAAGTCTGTTTTCATCATATTCTTCCAAGGAGACCAGCTGAAGAACAGGGGTAAGAAGATCTGCGAGGGGGTTCCGTGCATCCCTTTATCCGTGCCCAGAGACCCCCTCAGGAAGCGTTAAGGAAATGGCAACTTGAAGTGGAACACAAGGGATTGAAGGGAATCTTGCAAGAT
Full Trace Sequence: CAGATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGGAACTCTTCCGAAGTGAGGAGATGACCTTGGCCCAGCTTTTCCTTCAGTCTGAAGCTGCTTATTGCTGTGTTAGTGAACTGGGAGAGCTGGGGAAAGTCCAGTTTAGAGATTTAAATCCAGATGTCAATGTATTCCAGAGGAAATTTGTCAATGAGGTCCGAAGATGCGAAGAAATGGACCGTAAACTGCGGTTTGTGGAAAAGGAGGTGAAGAAAGCAAATATTTCAATCCTTGACACTGGCGAGAACCCAGAAGTCCCCTTTCCTAGGGACATTATTGACCTTGAGGCAAATTTTGAAAAGATTGAGATTGAACTGAAAGAAATAAACACAAACCAAGAGGCTTTGAAGAGGAACTTCCTTGAACTGACGGAGTTAAAATTCATTCTGCGCAAAACCCAGCAATTTTTTGATGAGATGGCGGATCCGGATCTTTTGGAAGAATCCTCCACATTGCTGGAGCCCAGTGAGATGGGAAGAGGAGCGCCCTTAAGACTTGGCTTTGTGGCTGGAGTGATTAATCGTGAGAGGATCCCAACCTTCGAGAGGATGCTGTGGCGTGTTTGTCGTGGAAATGTCTTCTTGCGTCAGGCACAGATTGAAAACCCATTGGAGGATCCCGTTACGGGTGACAGTGTTCACAAGTCTGTTTTCATCATATTCTTCCAAGGAGACCAGCTGAAGAACAGGGGTAAGAAGATCTGCGAGGGGGTTCCGTGCATCCCTTTATCCGTGCCCAGAGACCCCCTCAGGAAGCGTTAAGGAAATGGCAACTTGAAGTGGAACACAAGGGATTGAAGGGAATCTTGCAAGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGGAACTCTTCCGAAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ828958
dbEST ID: 79646660
Trimmed Sequence: ATCATCGAATTTCCCTTCCCAGATTGTCTCAAATGAAAACGGCAGAAATTTGAACCCGGTGCCCATGTAAAACTTGTTCCGAAATTCCACCCAGTGCAATCGAAGAGCGTGGAGAAAAGCGGACAGTCCTTCCATGATAAGTAGGATAGCGATGGTCAGGGTGGCAAATGCAGAAAAGATGAAGACCAAGGCGATGCCTCCACCCAGACTTCGGATATTTAGGCCAATGTGCATGACCATAGTCCATAAAACCTCCGACAGTTGTGCGTGTGCCAAACTCAAGGCCCAAAGTCGGAGGTACGAGGCGGTGTTAGAAATACAACCCAGACAGTATTCAATGGTGTGTATGGCCTGATGGACCACGGTGTCTCCAAAATCAAACTCTTCTTCTTCATCTGAGTGCATGGAAAGCTGGTCATGCTGAATGATTTCGGCATCTTCCTCTGTGGGTCCGTTACCAACGCGGATGCCTCCGAAGTTATGCGTACCCAAATGTTTTCTTCTCAAGTATTGGCGGCGTAAAATAAGGGGTTTAAGCACAAGCATCCAGGGTACGCAAATAATTGCACATACAACCAGGAAGCACTGCAACCCCATCTGGCCCTTGTAGAGCATAGGCAGGCTGGTGTCTTGGTAGCTGAAGAAGAACATGGTTGATGAAGTGAATAAAGGAGACTCGGTGCCAACCCATGGAGGTTTGATACATCAAATGCCCACCCACTTGGTAAATTTATAATTATGACCAAATAAACCCAAAACAAAATAAATCAAAAA
Full Trace Sequence: ACGCGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCATCGAATTTCCCTTCCCAGATTGTCTCAAATGAAAACGGCAGAAATTTGAACCCGGTGCCCATGTAAAACTTGTTCCGAAATTCCACCCAGTGCAATCGAAGAGCGTGGAGAAAAGCGGACAGTCCTTCCATGATAAGTAGGATAGCGATGGTCAGGGTGGCAAATGCAGAAAAGATGAAGACCAAGGCGATGCCTCCACCCAGACTTCGGATATTTAGGCCAATGTGCATGACCATAGTCCATAAAACCTCCGACAGTTGTGCGTGTGCCAAACTCAAGGCCCAAAGTCGGAGGTACGAGGCGGTGTTAGAAATACAACCCAGACAGTATTCAATGGTGTGTATGGCCTGATGGACCACGGTGTCTCCAAAATCAAACTCTTCTTCTTCATCTGAGTGCATGGAAAGCTGGTCATGCTGAATGATTTCGGCATCTTCCTCTGTGGGTCCGTTACCAACGCGGATGCCTCCGAAGTTATGCGTACCCAAATGTTTTCTTCTCAAGTATTGGCGGCGTAAAATAAGGGGTTTAAGCACAAGCATCCAGGGTACGCAAATAATTGCACATACAACCAGGAAGCACTGCAACCCCATCTGGCCCTTGTAGAGCATAGGCAGGCTGGTGTCTTGGTAGCTGAAGAAGAACATGGTTGATGAAGTGAATAAAGGAGACTCGGTGCCAACCCATGGAGGTTTGATACATCAAATGCCCACCCACTTGGTAAATTTATAATTATGACCAAATAAACCCAAAACAAAATAAATCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCATCGAATTTCCCTTCCCA