ORFeome > atp6v1b1 ORF1 – XORFeome v1.0

atp6v1b1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp6v1b1
Gene ID: 865560
Gene Page ID: 485913
ORF Xenbase ID: 17265669

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC123236
Original XGC clone length: 1521

Human orthology & disease relationships

NCBI Entrez ID: 525
Ensembl gene IDs: ENSG00000116039
Directly associated (OMIM) disease MIM numbers: 267300
Indirectly associated (Lage, et al.) disease MIM numbers: 267300

Library Location

Plate ID: GDExl11089
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ838259
dbEST ID: 79655961
Trimmed Sequence: ATGAGGGTGGAGGGGCACCAGGCAAATATGGCGGCGGCGAAGGAGCACATGCTGGCAGTGACCAGGAACTACATCTCCCACCCCAGGCTCAGTTACAGGACAGTGTGCGGAGTGAACGGACCTCTGGTTGTACTGGATAATGTCAAGTTTGCCCAGTATGCGGAAATCGTCAACTTCACTCTACCCGATGGTACAATTCGGAGTGGGCAAATCCTGGAGGTTGCAGGTTCTAAGGCCATTGTGCAGGTGTTTGAAGGAACATCTGGGATCGATGCCAAGAAAACAACCTGCGAATTCACGGGCGACATTCTCCGGACACCTGTCTCAAAGGACATGCTGGGGCGTGTATTCAACGGTTCTGGAAAACCTATTGACAAAGGTCCCACGGTGATGGCGGAAGATTTTTTAGATATCAATGGACAGCCAATCAACCCCTATGGCCGAACATACCCCGAGGAGATGATTCAGACGGGGATCTCACCTATTGATGTCATGAACAGCATTGCCAGAGGGCAGAAAATCCCCATCTTTTCAGCCGCCGGTCTGCCCCATAATGAGATAGCAGCTCAGATCTGCAGGCAGGCCGTAAAGCTCACTT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGGTGGAGGGGCACCAGGCAAATATGGCGGCGGCGAAGGAGCACATGCTGGCAGTGACCAGGAACTACATCTCCCACCCCAGGCTCAGTTACAGGACAGTGTGCGGAGTGAACGGACCTCTGGTTGTACTGGATAATGTCAAGTTTGCCCAGTATGCGGAAATCGTCAACTTCACTCTACCCGATGGTACAATTCGGAGTGGGCAAATCCTGGAGGTTGCAGGTTCTAAGGCCATTGTGCAGGTGTTTGAAGGAACATCTGGGATCGATGCCAAGAAAACAACCTGCGAATTCACGGGCGACATTCTCCGGACACCTGTCTCAAAGGACATGCTGGGGCGTGTATTCAACGGTTCTGGAAAACCTATTGACAAAGGTCCCACGGTGATGGCGGAAGATTTTTTAGATATCAATGGACAGCCAATCAACCCCTATGGCCGAACATACCCCGAGGAGATGATTCAGACGGGGATCTCACCTATTGATGTCATGAACAGCATTGCCAGAGGGCAGAAAATCCCCATCTTTTCAGCCGCCGGTCTGCCCCATAATGAGATAGCAGCTCAGATCTGCAGGCAGGCCGTAAAGCTCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATGAAAAAGCATTGCTTATCATTTTGTTGCAACGAACAGGTCACTATTAGTTCAAATAAAATCATTATTTTCCATCCAGCTTAAAATCCCCAATATTGGGTAAAAAAAAAAAAAAAAAAAAAATTTTCTTGGCCCCTTTTTGACCGCGCCCCAAAAAAACCCCCAAAATCTTTACAAACCCCCGGAGGCGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGGTGGAGGGGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ838258
dbEST ID: 79655960
Trimmed Sequence: GTGAGCTTTACGGCCTGCCTGCAGATCTGAGCTGCTATCTCATTATGGGGCAGACCGGCGGCTGAAAAGATGGGGATTTTCTGCCCTCTGGCAATGCTGTTCATGACATCAATAGGTGAGATCCCCGTCTGAATCATCTCCTCGGGGTATGTTCGGCCATAGGGGTTGATTGGCTGTCCATTGATATCTAAAAAATCTTCCGCCATCACCGTGGGACCTTTGTCAATAGGTTTTCCAGAACCGTTGAATACACGCCCCAGCATGTCCTCTGAGACAGGTGTCCGGAGAATGTCGCCCGTGAATTCGCAGGTTGTTTTCTTGGCATCGATCCCAGATGTTCCTTCAAACACCTGCACAATGGCCTTAGAACCTGCAACCTCCAGGATTTGCCCACTCCGAATTGTACCATCGGGTAGAGTGAAGTTGACGATTTCCGCATACTGGGCAAACTTGACATTATCCAGTACAACCAGAGGTCCGTTCACTCCGCACACTGTCCTGTAACTGAGCCTGGGGTGGGAGATGTAGTTCCTGGTCACTGCCAGCATGTGCTCCTTCGCCGCCGCCCTATTTGCCTGGTGCCGGCTCCCCTCATGGGTGCGAGTTTTTTGGTACAGGTTGGCGTTTTAAAAAGCATTTCTTCATCATTTTGTTGCAACAAACAAGTGCGCTATCATTCCAAAAAAAAAGAAATAAAAAAAAATCTAAATTTAGAGACCTAGCCGATCAGTGCAGGAAAAATACATAACAAAGGGGTTTCTTCTC
Full Trace Sequence: CGGAAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAGCTTTACGGCCTGCCTGCAGATCTGAGCTGCTATCTCATTATGGGGCAGACCGGCGGCTGAAAAGATGGGGATTTTCTGCCCTCTGGCAATGCTGTTCATGACATCAATAGGTGAGATCCCCGTCTGAATCATCTCCTCGGGGTATGTTCGGCCATAGGGGTTGATTGGCTGTCCATTGATATCTAAAAAATCTTCCGCCATCACCGTGGGACCTTTGTCAATAGGTTTTCCAGAACCGTTGAATACACGCCCCAGCATGTCCTCTGAGACAGGTGTCCGGAGAATGTCGCCCGTGAATTCGCAGGTTGTTTTCTTGGCATCGATCCCAGATGTTCCTTCAAACACCTGCACAATGGCCTTAGAACCTGCAACCTCCAGGATTTGCCCACTCCGAATTGTACCATCGGGTAGAGTGAAGTTGACGATTTCCGCATACTGGGCAAACTTGACATTATCCAGTACAACCAGAGGTCCGTTCACTCCGCACACTGTCCTGTAACTGAGCCTGGGGTGGGAGATGTAGTTCCTGGTCACTGCCAGCATGTGCTCCTTCGCCGCCGCCCTATTTGCCTGGTGCCGGCTCCCCTCATGGGTGCGAGTTTTTTGGTACAGGTTGGCGTTTTAAAAAGCATTTCTTCATCATTTTGTTGCAACAAACAAGTGCGCTATCATTCCAAAAAAAAAGAAATAAAAAAAAATCTAAATTTAGAGACCTAGCCGATCAGTGCAGGAAAAATACATAACAAAGGGGTTTCTTCTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAGCTTTACGGCCTG