ORFeome > atp6v1b2 ORF1 – XORFeome v1.0

atp6v1b2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atp6v1b2
Gene ID: 941738
Gene Page ID: 941730
ORF Xenbase ID: 17265675

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046738
Original XGC clone length: 1536

Human orthology & disease relationships

NCBI Entrez ID: 526
Ensembl gene IDs: ENSG00000147416
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 103050,180105,268000,300240,305000,603896,608688,610015

Library Location

Plate ID: GDExl11012
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ824018
dbEST ID: 79641720
Trimmed Sequence: ATGGCGGTGCGTGTAATGCGGGGCGGTGAGATTGGAACCGGAGTTAAGGGCGGCCCGGGGAATCCCGTAGGCGCAGCTGCCAGAGAACATGTACAGGCGGTCAGCAGAGACTACCTGTCCCAGCCCAGGCTGACTTATCGCACAGTGTCTGGTGTTAATGGGCCCCTGGTTATCCTAGACAATGTCAAGTTTCCCAGGTACTCCGAGATTGTTCACCTGACTCTCCCAGATGGCACAAAGAGGAGTGGGCAGGTACTTGAGGTCAGCGGATCCAAAGCTGTGGTACAGGTGTTTGAGGGCACATCTGGCATTGATGCAAAGAAAACTTCATGTGAGTTCTCTGGGGATATTCTCAGGACACCAGTATCCGAGGACATGTTGGGACGTGTATTTAATGGTTCGGGAAAGCCTATCGATCGTGGTCCTAGTGTTTTAGCTGAGGATTATCTGGATATAATGGGGCAGCCCATTAATCCCCAGTGCAGAATCTACCCTGAAGAGATGATCCAAACAGGGATCTCTGCTATAGATGGTATGAACAGCATTGCCCGTGGTCAGAAAATCCCTATTTTCTCTGCTGCTGGTCTTCCACATAATGAGATTGCAGCTCAGATCTGTCGCCAAGCAGGCCTGGTGAAGAAATCTAAAGATGTGATGGATTATAGTGAGGATAACTTTGCCATAGTCTTTGCTGCTATGGGGGTTAACATGGAGACTGCTCGAT
Full Trace Sequence: CATTATTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGCGTGTAATGCGGGGCGGTGAGATTGGAACCGGAGTTAAGGGCGGCCCGGGGAATCCCGTAGGCGCAGCTGCCAGAGAACATGTACAGGCGGTCAGCAGAGACTACCTGTCCCAGCCCAGGCTGACTTATCGCACAGTGTCTGGTGTTAATGGGCCCCTGGTTATCCTAGACAATGTCAAGTTTCCCAGGTACTCCGAGATTGTTCACCTGACTCTCCCAGATGGCACAAAGAGGAGTGGGCAGGTACTTGAGGTCAGCGGATCCAAAGCTGTGGTACAGGTGTTTGAGGGCACATCTGGCATTGATGCAAAGAAAACTTCATGTGAGTTCTCTGGGGATATTCTCAGGACACCAGTATCCGAGGACATGTTGGGACGTGTATTTAATGGTTCGGGAAAGCCTATCGATCGTGGTCCTAGTGTTTTAGCTGAGGATTATCTGGATATAATGGGGCAGCCCATTAATCCCCAGTGCAGAATCTACCCTGAAGAGATGATCCAAACAGGGATCTCTGCTATAGATGGTATGAACAGCATTGCCCGTGGTCAGAAAATCCCTATTTTCTCTGCTGCTGGTCTTCCACATAATGAGATTGCAGCTCAGATCTGTCGCCAAGCAGGCCTGGTGAAGAAATCTAAAGATGTGATGGATTATAGTGAGGATAACTTTGCCATAGTCTTTGCTGCTATGGGGGTTAACATGGAGACTGCTCGAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGTGCGTGTAATG

Sequences - 3ʹ (reverse) EST

Accession: JZ829326
dbEST ID: 79647028
Trimmed Sequence: GTGCTTGGCAGATGAGTCTCGGGGGTAGAATTCTGCAAGGGTGCTCTGGGGAATTCTCTTCAGCAACTCTTTGGGGAAAATTCGAAGAAGCTGCCATCCAATATCCAGCGTCTCGTAAACTGTGCGGTTGTCATATGGACCTTGCGCAATGAAATTCTTTTCAAATTTCTGTAGAAACTCCAAGTAGAGAAGATCATCGGAGGTCAGAGCCTCCTCTCCAACTACGGCCTTCATGGCTTGTACATCCTTTCCAATTGCATAGCAGGCATACAGCTGATTAGATACATCGGAGTGGTCCTTTCTTGTCATGCCTTCCCCAATGGCAGACTTCATCAAACGGGAAAGCGAGGGAAGCACATTTATGGGTGGGTAGATCTGTCTGTTGTGTAACTGCCTGTCCACGTAAATCTGTCCTTCAGTGATATATCCGGTCAAATCAGGAATGGGGTGAGTGATATCATCGTTAGGCATGGTTAGTATAGGGATCTGAGTAATAGAACCATTTCTCCCCTCCACACGCCCAGCTCGTTCATAGATTGTAGCCAGATCAGTGTACATATAACCTGGGGAACCCTCGGGCGACCAGGAACTTCTTCTCTAGCTGCAGATACCTCTCTCAAAGCCTCAGCATAGGAACTCATGTCAATCAAGAATACCAACACATGGCTTCTCACACTGGATAAGCCAAAGAATTCGGCCAGAGGTGAACGCCGAAGACCCGGGGGGTGATTTATACCGTTTCAATTTTGTTTGGGGT
Full Trace Sequence: GCTGCCGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCTTGGCAGATGAGTCTCGGGGGTAGAATTCTGCAAGGGTGCTCTGGGGAATTCTCTTCAGCAACTCTTTGGGGAAAATTCGAAGAAGCTGCCATCCAATATCCAGCGTCTCGTAAACTGTGCGGTTGTCATATGGACCTTGCGCAATGAAATTCTTTTCAAATTTCTGTAGAAACTCCAAGTAGAGAAGATCATCGGAGGTCAGAGCCTCCTCTCCAACTACGGCCTTCATGGCTTGTACATCCTTTCCAATTGCATAGCAGGCATACAGCTGATTAGATACATCGGAGTGGTCCTTTCTTGTCATGCCTTCCCCAATGGCAGACTTCATCAAACGGGAAAGCGAGGGAAGCACATTTATGGGTGGGTAGATCTGTCTGTTGTGTAACTGCCTGTCCACGTAAATCTGTCCTTCAGTGATATATCCGGTCAAATCAGGAATGGGGTGAGTGATATCATCGTTAGGCATGGTTAGTATAGGGATCTGAGTAATAGAACCATTTCTCCCCTCCACACGCCCAGCTCGTTCATAGATTGTAGCCAGATCAGTGTACATATAACCTGGGGAACCCTCGGGCGACCAGGAACTTCTTCTCTAGCTGCAGATACCTCTCTCAAAGCCTCAGCATAGGAACTCATGTCAATCAAGAATACCAACACATGGCTTCTCACACTGGATAAGCCAAAGAATTCGGCCAGAGGTGAACGCCGAAGACCCGGGGGGTGATTTATACCGTTTCAATTTTGTTTGGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCTTGGCAGATGAGTCTCGG