ORFeome > atp6v1e1 ORF1 – XORFeome v1.0

atp6v1e1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: atp6v1e1
Gene ID: 6255807
Gene Page ID: 1006141
ORF Xenbase ID: 17265693

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054191
Original XGC clone length: 681

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ839114
dbEST ID: 79656816
Trimmed Sequence: ATGGCGCTGAGCGATGCCGACGTACAGAAACAGATCAAGCACATGATGGCTTTCATTGAGCAGGAAGCCAACGAGAAGGCGGAAGAAATAGATGCCAAGGCAGAAGAGGAGTTTAACATTGAGAAGGGCCGACTGGTGCAGACCCAGAGACTGAAGATCATGGAGTATTATGAGAAGAAGGAGAAACAGATTGAGCAACAAAAGAAAATTCAGATGTCAAACCTGCTGAACCAAGCTCGTCTGAAGGTGCTTAAAGCTCGTGATGATCACATTTCGGATTTGGTGAATGAGGCCAGGCAGAGACTCGCCCGGGTGGTGAAGGACACGGCTCGGTACCAGATGTTGCTTGATGGACTCATTCTACAGGGTCTGTTCCAACTCCTGGAACCCAAGGTGGTGATCCGCTGCCGTAAGCAAGACCTCCCTCTAATTACGGCTTCCGTGCAGAAGAGCATCCCCACTTACAAGGCTGCTACCAAACAAGGGGTGGAGGTGATCATTGATCAAGAGACTCATCTAACCCCCGAAATAGCTGGAGGAGTGGAGCTTTATAACGGCAATGGGAAGATCAAAGTGTCAAACACGCTGGAGAGTCGGCTGGACTTGATTGCTCCGCAGATGATGCCAGAAATCCAAGTTGCTTTATTTGGGGCCAACACCAACCAAAAGTTCCTGGAATGGCCGGCTTTCTTGTACAAAGTTGGGCTTGTATAGGAAGGCATTGGCTTTATAAATTGGTTGGAAACAAAAAGGGCACTTAACAAGTCCAAAAAAAAAAATACATTAATTTTCCCTTCCCGGCTTAGAAAATCCCCCCCAAAGGGT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAGCGATGCCGACGTACAGAAACAGATCAAGCACATGATGGCTTTCATTGAGCAGGAAGCCAACGAGAAGGCGGAAGAAATAGATGCCAAGGCAGAAGAGGAGTTTAACATTGAGAAGGGCCGACTGGTGCAGACCCAGAGACTGAAGATCATGGAGTATTATGAGAAGAAGGAGAAACAGATTGAGCAACAAAAGAAAATTCAGATGTCAAACCTGCTGAACCAAGCTCGTCTGAAGGTGCTTAAAGCTCGTGATGATCACATTTCGGATTTGGTGAATGAGGCCAGGCAGAGACTCGCCCGGGTGGTGAAGGACACGGCTCGGTACCAGATGTTGCTTGATGGACTCATTCTACAGGGTCTGTTCCAACTCCTGGAACCCAAGGTGGTGATCCGCTGCCGTAAGCAAGACCTCCCTCTAATTACGGCTTCCGTGCAGAAGAGCATCCCCACTTACAAGGCTGCTACCAAACAAGGGGTGGAGGTGATCATTGATCAAGAGACTCATCTAACCCCCGAAATAGCTGGAGGAGTGGAGCTTTATAACGGCAATGGGAAGATCAAAGTGTCAAACACGCTGGAGAGTCGGCTGGACTTGATTGCTCCGCAGATGATGCCAGAAATCCAAGTTGCTTTATTTGGGGCCAACACCAACCAAAAGTTCCTGGAATGGCCGGCTTTCTTGTACAAAGTTGGGCTTGTATAGGAAGGCATTGGCTTTATAAATTGGTTGGAAACAAAAAGGGCACTTAACAAGTCCAAAAAAAAAAATACATTAATTTTCCCTTCCCGGCTTAGAAAATCCCCCCCAAAGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTGAGCGATGCCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839113
dbEST ID: 79656815
Trimmed Sequence: GTCCAGGAACTTTCGGTTGGTGTTGGCCCCAAATAAAGCAACTCGGATTTCTGGCATCATCTGCTGAGCAATCAAGTCCAGCCGACTCTCCAGCGTGTTTGACACTTTGATTTTCCCATTGCCGTTATAAAGCTCCACTCCTCCAGCTATTTCGGGGGTTAGATGAGTCTCTTGATCAATGATCACCTCCACCCCTTGTTTGGTAGCAGCCTTGTAAGTGGGGATGCTCTTCTGCACGGAAGCCGTAATTAGAGGGAGGTCTTGCTTACGGCAGCGGATCACCACCTTGGGTTCCAGGAGTTGGAACAGACCCTGTAGAATGAGTCCATCAAGCAACATCTGGTACCGAGCCGTGTCCTTCACCACCCGGGCGAGTCTCTGCCTGGCCTCATTCACCAAATCCGAAATGTGATCATCACGAGCTTTAAGCACCTTCAGACGAGCTTGGTTCAACAGGTTTGACATCTGAAATTTTCTTTTGTTGCTCAATCTGTTTCTCCTTCTTCTCATAATACTCCATGATCTTCAGTCTCTGGGTCTGCACCCCATCGGCCCTTCTCCATGGTTAAACTCCTCTTCTGCCTTGGACATCTATTTCTTTCCCCTTCCTCGTTGCCTTCCTGCTCAATGAAAACCCATCATTTGTTTGAATTGGTTTCTGGTACAACCGCCTTCGCCCAGCCGCCCGGGGTGCCAAATTTTTTTGGACAAAGTGTGGGAATTTATAAAAAAACCCTTTGTCTCCATTCATATTTTGTTTGCCAAACAAAAAAGAGTTCCCCTA
Full Trace Sequence: GCGAGCAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCAGGAACTTTCGGTTGGTGTTGGCCCCAAATAAAGCAACTCGGATTTCTGGCATCATCTGCTGAGCAATCAAGTCCAGCCGACTCTCCAGCGTGTTTGACACTTTGATTTTCCCATTGCCGTTATAAAGCTCCACTCCTCCAGCTATTTCGGGGGTTAGATGAGTCTCTTGATCAATGATCACCTCCACCCCTTGTTTGGTAGCAGCCTTGTAAGTGGGGATGCTCTTCTGCACGGAAGCCGTAATTAGAGGGAGGTCTTGCTTACGGCAGCGGATCACCACCTTGGGTTCCAGGAGTTGGAACAGACCCTGTAGAATGAGTCCATCAAGCAACATCTGGTACCGAGCCGTGTCCTTCACCACCCGGGCGAGTCTCTGCCTGGCCTCATTCACCAAATCCGAAATGTGATCATCACGAGCTTTAAGCACCTTCAGACGAGCTTGGTTCAACAGGTTTGACATCTGAAATTTTCTTTTGTTGCTCAATCTGTTTCTCCTTCTTCTCATAATACTCCATGATCTTCAGTCTCTGGGTCTGCACCCCATCGGCCCTTCTCCATGGTTAAACTCCTCTTCTGCCTTGGACATCTATTTCTTTCCCCTTCCTCGTTGCCTTCCTGCTCAATGAAAACCCATCATTTGTTTGAATTGGTTTCTGGTACAACCGCCTTCGCCCAGCCGCCCGGGGTGCCAAATTTTTTTGGACAAAGTGTGGGAATTTATAAAAAAACCCTTTGTCTCCATTCATATTTTGTTTGCCAAACAAAAAAGAGTTCCCCTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCAGGAACTTTCGGTTG