ORFeome > atpaf2 ORF1 – XORFeome v1.0

atpaf2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: atpaf2
Gene ID: 6254282
Gene Page ID: 972825
ORF Xenbase ID: 17265723

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097914
Original XGC clone length: 855

Human orthology & disease relationships

NCBI Entrez ID: 91647
Ensembl gene IDs: ENSG00000171953
Directly associated (OMIM) disease MIM numbers: 604273
Indirectly associated (Lage, et al.) disease MIM numbers: 604273

Library Location

Plate ID: GDExl11089
Well Location: D10

Sequences - 5ʹ (forward) EST

Accession: JZ838441
dbEST ID: 79656143
Trimmed Sequence: ATGCTGCCCAGTTTTCAAGCGATCGCTTCCCGGAGGATTTTTGCCTCGCCGGCTCCTCTTATTCGGGCAGTTCAGGCAGCTCCTCACAAGGACAAGCGTTTCTATGCAGTGGCTGTAGAAAGAAAAAAGTTCTATGAAAATGTCAGCATTTCCCATGGAGAAGGGGGGTTTGAAATTAACCTGGATCGGAGGAAGCTTAAGACGCCCCAGGGGAAATTATTTGCTGTTCCCAGCGAGGCTTTGGCTCTAGCTGTGGCCACAGAATGGGACTGCCAGAGAGATGTGATCAAGTTCTACACCATGCAGTTGACCACACTGTGCAACACAGCCTTGGATAACCCCACTCTAATAAACAAGGAACAGCTTATTAAACCTGCTTTGAAATTCTTGGAGACCGACACCATCTGTTACAGAGTAGAAGATCCCCCGGGGCTGGTGGAGCTGCAGAAAAATGAGTGGGATCCAGTGATTGAATGGGCAGAAAAAAGATACAACGTTGTGATTGGATCCTCCACAAGCATCCATGGGCGCATCATTGCCAACGGAGACCGAAGAATGTGTTAGCCCGCATCTGGCGTCGGACAATTCCGGGGGGATTATTATGGATTGAAGTTAATCTTTCCCCAACTCAAGTCCCACACCCCCGCGCGGGGGGACTAAGGGCCCAACCACTGCGCAGTGGGAAGAAAAAAGAAACCTCGTTTCCCCCCCTAAAAGGAGAAAAAGCAAAAACCAAGCGTTGGGGGA
Full Trace Sequence: CGAGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGCCCAGTTTTCAAGCGATCGCTTCCCGGAGGATTTTTGCCTCGCCGGCTCCTCTTATTCGGGCAGTTCAGGCAGCTCCTCACAAGGACAAGCGTTTCTATGCAGTGGCTGTAGAAAGAAAAAAGTTCTATGAAAATGTCAGCATTTCCCATGGAGAAGGGGGGTTTGAAATTAACCTGGATCGGAGGAAGCTTAAGACGCCCCAGGGGAAATTATTTGCTGTTCCCAGCGAGGCTTTGGCTCTAGCTGTGGCCACAGAATGGGACTGCCAGAGAGATGTGATCAAGTTCTACACCATGCAGTTGACCACACTGTGCAACACAGCCTTGGATAACCCCACTCTAATAAACAAGGAACAGCTTATTAAACCTGCTTTGAAATTCTTGGAGACCGACACCATCTGTTACAGAGTAGAAGATCCCCCGGGGCTGGTGGAGCTGCAGAAAAATGAGTGGGATCCAGTGATTGAATGGGCAGAAAAAAGATACAACGTTGTGATTGGATCCTCCACAAGCATCCATGGGCGCATCATTGCCAACGGAGACCGAAGAATGTGTTAGCCCGCATCTGGCGTCGGACAATTCCGGGGGGATTATTATGGATTGAAGTTAATCTTTCCCCAACTCAAGTCCCACACCCCCGCGCGGGGGGACTAAGGGCCCAACCACTGCGCAGTGGGAAGAAAAAAGAAACCTCGTTTCCCCCCCTAAAAGGAGAAAAAGCAAAAACCAAGCGTTGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCCCAGTTTTCAAGCGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838440
dbEST ID: 79656142
Trimmed Sequence: GTCCTGCAATAGCTTGTGTTTAATGGTAGAGCTTTCAGAGCAAAGATGTACAAAGAGGGTCCCGGCGGCTGTGCGAGAACGCAGCTCTTGCAGGTCATAATCATGCGCCCATTCCACATTTCCCCAACGCTGGATCTGATACTCTTCTTCTAAGCGAGACAGGAGAACGGCTTTCTCCACTGGCAGGTGTCGGTCGATAAGTCCCATGGTCAGGATGAAGGACTTGAGTTGAGAAATGATAAACTCGATACCTAATAATCCCCAGGAATTGTAGGACGCCGGATGACGGCTAAAAACATCTTTGGTCTCCGTTGGAATGATGGGCCCATGGATGCTTGTGGAGGATCCAATCACAACGTTTTATCTTTTTTCTGCCCATTCAATCGCTGGAGCGGACTCCTTTTTCTGCAGCGGCCGCCGCCCCGGAGGGAGCGGGGACACTGTAACAGAATAGTGTCGGTGTCGCACACATTCAAAGCACATTGGAGTAAAAAGTTCCTTGTTTCTGGGAATTGGGGGGGGGCGGGGGCGGGGGGGGGGCGTGTGAAGGGGGGGGGTATAATTGTAGGGGGTGGAGGGGGAAGTCTCTCGGCGTACGCAGGTCGTCGGACAAGAGGAGGAAAGCGGGGGCGCTCCCTACGCAGAAGAGAGAGAAAAAGTACGCGAAAGAGCGAGGGGGGGGGGGGGGGCGGAGGGCGGGCGGAGAGGGGGGGGTGTGCTTCCC
Full Trace Sequence: GGGGAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCCTGCAATAGCTTGTGTTTAATGGTAGAGCTTTCAGAGCAAAGATGTACAAAGAGGGTCCCGGCGGCTGTGCGAGAACGCAGCTCTTGCAGGTCATAATCATGCGCCCATTCCACATTTCCCCAACGCTGGATCTGATACTCTTCTTCTAAGCGAGACAGGAGAACGGCTTTCTCCACTGGCAGGTGTCGGTCGATAAGTCCCATGGTCAGGATGAAGGACTTGAGTTGAGAAATGATAAACTCGATACCTAATAATCCCCAGGAATTGTAGGACGCCGGATGACGGCTAAAAACATCTTTGGTCTCCGTTGGAATGATGGGCCCATGGATGCTTGTGGAGGATCCAATCACAACGTTTTATCTTTTTTCTGCCCATTCAATCGCTGGAGCGGACTCCTTTTTCTGCAGCGGCCGCCGCCCCGGAGGGAGCGGGGACACTGTAACAGAATAGTGTCGGTGTCGCACACATTCAAAGCACATTGGAGTAAAAAGTTCCTTGTTTCTGGGAATTGGGGGGGGGCGGGGGCGGGGGGGGGGCGTGTGAAGGGGGGGGGTATAATTGTAGGGGGTGGAGGGGGAAGTCTCTCGGCGTACGCAGGTCGTCGGACAAGAGGAGGAAAGCGGGGGCGCTCCCTACGCAGAAGAGAGAGAAAAAGTACGCGAAAGAGCGAGGGGGGGGGGGGGGGCGGAGGGCGGGCGGAGAGGGGGGGGTGTGCTTCCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTGCAATAGCTTGTGT