ORFeome > auh ORF1 – XORFeome v1.0

auh ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: auh
Gene ID: 963004
Gene Page ID: 962999
ORF Xenbase ID: 17265771

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097787
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID: 549
Ensembl gene IDs: ENSG00000148090,LRG_449
Directly associated (OMIM) disease MIM numbers: 250950
Indirectly associated (Lage, et al.) disease MIM numbers: 203750,210200,210210,231530,243500,245050,250950,300438,606054,609015,609975

Library Location

Plate ID: GDExl11089
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ838355
dbEST ID: 79656057
Trimmed Sequence: ATGGCAGCTCTAGCTGGTCTGAGGGTCTTAAGCTGCGGCAGTGGAGCCAGAATGACTTCACGCGCCGCCTCGTGGCTGCTACTTCGCACCCCCCACGCTGCGCAGGTACAGGTGGGGGTCAGTGGGTGCGGCCACGGGGAGCGCTATAACAGCTCGGCCGAGAAGGGCGAAGACGAGCTAAGGGTCAGATACTTGGAAGGTGACGAGCAAGGTATTGTGGTGCTTGGGATAAATCGACCACAGGCCAAAAATGCAATTAGTAAAAGTCTGGTTAAATCGATGATGAAGATGATAGATTCCCTGAAAGGTAATAACAAAGTAAGGACAGTAGTCTTACGGAGTGAAGTTCCTGGAGTCTTTTGTGCAGGAGCTGATCTAAAGGAAAGAGCGAAAATGCACCCTAGTGAGGTTGGACCTTTTGTATCAAGAGCTCGAGCACTTATGAATGAATTTGCTAATCTTCCAATGCCAACCATTGCTGCTTTGGATGGGGCTGCATTAGGAGGAGGCCTAGAGATGGCACTGGCCTGTGACATCATAGTAGCAGCTTCTTCTGCTAAAATGGGTTTGGTTGAAACAAAATTGGCAATTATTCCTGGTGCAGGGGGAACACAGAGACTCCCACGTGCAGTGGGAGTGGCTTTGGCAAAAAAGCTTATCTTCTCTGCTCGTGTACTAGATGGAAATGAAGCCAAGTCACTTGGATTGGTCAGTTCCGTGGTAAAA
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTCTAGCTGGTCTGAGGGTCTTAAGCTGCGGCAGTGGAGCCAGAATGACTTCACGCGCCGCCTCGTGGCTGCTACTTCGCACCCCCCACGCTGCGCAGGTACAGGTGGGGGTCAGTGGGTGCGGCCACGGGGAGCGCTATAACAGCTCGGCCGAGAAGGGCGAAGACGAGCTAAGGGTCAGATACTTGGAAGGTGACGAGCAAGGTATTGTGGTGCTTGGGATAAATCGACCACAGGCCAAAAATGCAATTAGTAAAAGTCTGGTTAAATCGATGATGAAGATGATAGATTCCCTGAAAGGTAATAACAAAGTAAGGACAGTAGTCTTACGGAGTGAAGTTCCTGGAGTCTTTTGTGCAGGAGCTGATCTAAAGGAAAGAGCGAAAATGCACCCTAGTGAGGTTGGACCTTTTGTATCAAGAGCTCGAGCACTTATGAATGAATTTGCTAATCTTCCAATGCCAACCATTGCTGCTTTGGATGGGGCTGCATTAGGAGGAGGCCTAGAGATGGCACTGGCCTGTGACATCATAGTAGCAGCTTCTTCTGCTAAAATGGGTTTGGTTGAAACAAAATTGGCAATTATTCCTGGTGCAGGGGGAACACAGAGACTCCCACGTGCAGTGGGAGTGGCTTTGGCAAAAAAGCTTATCTTCTCTGCTCGTGTACTAGATGGAAATGAAGCCAAGTCACTTGGATTGGTCAGTTCCGTGGTAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTCTAGCTGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838354
dbEST ID: 79656056
Trimmed Sequence: CTCGCCCTTGTAACGAGGAGGCCTTTTTTCGTTAAATGCTAGCAAACCTTCAATTCTATCCTTTGTAGGAATAATCTGAGCATAGCAAGCTTCTTCTATAGCTAAACCAGTTGCCAAGTCCACTTCTATGCCTTGGTTAATTGCTAATTTAGCCATTCGCAATGCAATTGGTCCCTGAGGTGTAAATTCACGTGCTAGTGCAACAACTCTTTTAAAAGCTGCATCGCCGGCCTCATTCTGTTCTACCACGTGACTGACCAATCCAAGTGACTTGGCTTCATTTCCATCTAATACACGAGCAGAGAAGATAAGCTCTTTTGCCAAAGCCACTCCCACTGCACGTGGGAGTCTCTGTGTTCCCCCTGCACCAGGAATAATTGCCAATTTTGTTTCAACCAAACCCATTTTAGCAGAAGAAGCTGCTACTATGATGTCACAGGCCAGTGCCATCTCTAGGCCTCCTCCTAATGCAGCCCCATCCAAAGCAGCAATGGTTGGCATTGGAAGATTAGCAAATTCATTCATAAGTGCTCGAGCTCTTGATACAAAACGTCCAACCTCACTAGGGTGCATTTTCGCTCTTTCCTTTAGATCATCTCCTGGCCAAAAGACTCCCAGGAACTTCGCTCCATAAGACTACTGTCCTTACTTTTGTAATACCTTTCCAGGGAAACTATCATCCTCATCCTCCGATTTAACCAGACTTTTTCCAAATGA
Full Trace Sequence: GGGAAACAGCTATGCACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGCCCTTGTAACGAGGAGGCCTTTTTTCGTTAAATGCTAGCAAACCTTCAATTCTATCCTTTGTAGGAATAATCTGAGCATAGCAAGCTTCTTCTATAGCTAAACCAGTTGCCAAGTCCACTTCTATGCCTTGGTTAATTGCTAATTTAGCCATTCGCAATGCAATTGGTCCCTGAGGTGTAAATTCACGTGCTAGTGCAACAACTCTTTTAAAAGCTGCATCGCCGGCCTCATTCTGTTCTACCACGTGACTGACCAATCCAAGTGACTTGGCTTCATTTCCATCTAATACACGAGCAGAGAAGATAAGCTCTTTTGCCAAAGCCACTCCCACTGCACGTGGGAGTCTCTGTGTTCCCCCTGCACCAGGAATAATTGCCAATTTTGTTTCAACCAAACCCATTTTAGCAGAAGAAGCTGCTACTATGATGTCACAGGCCAGTGCCATCTCTAGGCCTCCTCCTAATGCAGCCCCATCCAAAGCAGCAATGGTTGGCATTGGAAGATTAGCAAATTCATTCATAAGTGCTCGAGCTCTTGATACAAAACGTCCAACCTCACTAGGGTGCATTTTCGCTCTTTCCTTTAGATCATCTCCTGGCCAAAAGACTCCCAGGAACTTCGCTCCATAAGACTACTGTCCTTACTTTTGTAATACCTTTCCAGGGAAACTATCATCCTCATCCTCCGATTTAACCAGACTTTTTCCAAATGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGCCCTTGTAACGAGGA