ORFeome > aurka ORF1 – XORFeome v1.0

aurka ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aurka
Gene ID: 866460
Gene Page ID: 853081
ORF Xenbase ID: 17265777

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC072133
Original XGC clone length: 1224

Human orthology & disease relationships

NCBI Entrez ID: 6790
Ensembl gene IDs: ENSG00000087586
Directly associated (OMIM) disease MIM numbers: 114500
Indirectly associated (Lage, et al.) disease MIM numbers: 133239,151623,210900,211980,223100,260500,275355,277700,307030,603903,607785,608354,608355

Library Location

Plate ID: GDExl11044
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ830532
dbEST ID: 79648234
Trimmed Sequence: ATGGAGCGGGCTGTTAAGGAGAACCACAAGCCTTCTAATGTGAAGATTTTTCACCCCATGACTGAGGGAGCTAAACGTATCCCAGTTAACCAGCCGCAGAGCACTCAGTTTAGGCCTCCTGGGACTGCAGTCTCTGCCCAGAGGATATTGGGTCCCTCTAATGTGCCGCAGCGAGTGTTGGCTCAGGCTCAGAAACCTATTCTGTCCAGTCAGAAGCCAACGACTCAGATCCCCCTGCGGCCAGCAACTCAAGGGCATCAGTCCAGCAAACCACAGGGACCAAATGAGAATCGCAATCCACAGCAGACAAGCCATTCCTCCACTCCAAATGTGGAAAAGAAAGGAAGCACCGATCAAGGAAAAACTTCAGCTGTTCCCAAAGAGGAGGGCAAAAAGAAACAATGGTGCCTGGAAGACTTTGAAATAGGGCGGCCCCTGGGCAAAGGGAAGTTTGGAAATGTTTATCTGGCACGCGAGCGGGAGAGTAAATTCATCCTGGCGCTGAAAGTCCTGTTTAAATCCCAGCTAGAGAAGGCGGGTGTAGAGCACCAGCTACGGCGGGAGGTGGAAATTCAGTCCCATCTCAGGCACCCCAATATTCTCCGGCTCTATGGCTATTTCCACGATGCTTTCCGAGTCTACCTAATCCTGGATTATGCCCCTGGGGGGGGAGTTGTTCAGAAAAGCTGCAGAAATGCACAAAGATTTGATGATCAAAAAAAATGCCCTGGTACCATCAAACCGCCTTGGCAGAAAGCCCCTTCCTGGTACTGGTTCCCTTCCAAAGAAAAGGGTAAATAACCAC
Full Trace Sequence: GGTCTTAGCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGGCTGTTAAGGAGAACCACAAGCCTTCTAATGTGAAGATTTTTCACCCCATGACTGAGGGAGCTAAACGTATCCCAGTTAACCAGCCGCAGAGCACTCAGTTTAGGCCTCCTGGGACTGCAGTCTCTGCCCAGAGGATATTGGGTCCCTCTAATGTGCCGCAGCGAGTGTTGGCTCAGGCTCAGAAACCTATTCTGTCCAGTCAGAAGCCAACGACTCAGATCCCCCTGCGGCCAGCAACTCAAGGGCATCAGTCCAGCAAACCACAGGGACCAAATGAGAATCGCAATCCACAGCAGACAAGCCATTCCTCCACTCCAAATGTGGAAAAGAAAGGAAGCACCGATCAAGGAAAAACTTCAGCTGTTCCCAAAGAGGAGGGCAAAAAGAAACAATGGTGCCTGGAAGACTTTGAAATAGGGCGGCCCCTGGGCAAAGGGAAGTTTGGAAATGTTTATCTGGCACGCGAGCGGGAGAGTAAATTCATCCTGGCGCTGAAAGTCCTGTTTAAATCCCAGCTAGAGAAGGCGGGTGTAGAGCACCAGCTACGGCGGGAGGTGGAAATTCAGTCCCATCTCAGGCACCCCAATATTCTCCGGCTCTATGGCTATTTCCACGATGCTTTCCGAGTCTACCTAATCCTGGATTATGCCCCTGGGGGGGGAGTTGTTCAGAAAAGCTGCAGAAATGCACAAAGATTTGATGATCAAAAAAAATGCCCTGGTACCATCAAACCGCCTTGGCAGAAAGCCCCTTCCTGGTACTGGTTCCCTTCCAAAGAAAAGGGTAAATAACCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGGCTGTTAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ830533
dbEST ID: 79648235
Trimmed Sequence: TTGGGCGCCTGGAAGGGGCTCGTCTTTCTTCTTGAGTTGAGAATTTTTTATGATCCATGGATGTTCGAGAACCCCTTTCAGTGGCAGCCTGTGGTTTGGGTTGTGCTTTAACAGCTTTGAGACAAGATCTCTTGCCTCTTCCGATACATATGGCGGATATTGAAATTCAACCTTTGAAATACGTCTGTAGGTTTCCTGGTGGGTGTCAGTCTCAAACGGAGGTTTCCCTACGAGGAATTCGTAACAGAGAACTCCCAGACTCCACAAGTCCACCGTCTCATCATGCATTCTGCCCTCGATCATCTCAGGAGGTAGATAGTCCAGTGTTCCACACAGAGTGGTCCTCCTGGAGGATGGAGCATGCACAGACCAGCCAAAGTCGGCGATCTTCAGTTCTCCATTGGAGCCAAGCAGCAAGTTCTCTGGCTTGATGTCCCTGTGTATCACCTTCTTGGAGTGACAGTACAGGAGGGCTTCTGCCAGCTGTTTGATGTACATGGCACTTCTCTGATCATCCAATCTTGTGCATTTCTGCAGCTCTCTGAACAACTCCCCCCCAGGGGCATAATCCAAGATTAGGGAAACTCTGGAAGCATCGTGGAAATAGCCCAAGAACCCGAAAAAATTGGGGTGCCTGAAAAGGGGACTGAATTTCCCACCTCCCGCCGCTAGCTGGGTGCCTTCACCCCCCCCTTCTTCTACTTGGGGATTTTAAACAGGGAACTTT
Full Trace Sequence: GGCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGGCGCCTGGAAGGGGCTCGTCTTTCTTCTTGAGTTGAGAATTTTTTATGATCCATGGATGTTCGAGAACCCCTTTCAGTGGCAGCCTGTGGTTTGGGTTGTGCTTTAACAGCTTTGAGACAAGATCTCTTGCCTCTTCCGATACATATGGCGGATATTGAAATTCAACCTTTGAAATACGTCTGTAGGTTTCCTGGTGGGTGTCAGTCTCAAACGGAGGTTTCCCTACGAGGAATTCGTAACAGAGAACTCCCAGACTCCACAAGTCCACCGTCTCATCATGCATTCTGCCCTCGATCATCTCAGGAGGTAGATAGTCCAGTGTTCCACACAGAGTGGTCCTCCTGGAGGATGGAGCATGCACAGACCAGCCAAAGTCGGCGATCTTCAGTTCTCCATTGGAGCCAAGCAGCAAGTTCTCTGGCTTGATGTCCCTGTGTATCACCTTCTTGGAGTGACAGTACAGGAGGGCTTCTGCCAGCTGTTTGATGTACATGGCACTTCTCTGATCATCCAATCTTGTGCATTTCTGCAGCTCTCTGAACAACTCCCCCCCAGGGGCATAATCCAAGATTAGGGAAACTCTGGAAGCATCGTGGAAATAGCCCAAGAACCCGAAAAAATTGGGGTGCCTGAAAAGGGGACTGAATTTCCCACCTCCCGCCGCTAGCTGGGTGCCTTCACCCCCCCCTTCTTCTACTTGGGGATTTTAAACAGGGAACTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGGCGCCTGGAAGGG