ORFeome > aven ORF1 – XORFeome v1.0

aven ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aven
Gene ID: 6256154
Gene Page ID: 6456682
ORF Xenbase ID: 17265801

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129562
Original XGC clone length: 900

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ837804
dbEST ID: 79655506
Trimmed Sequence: ATGGAGCGGGGCCGCGGAAGACACAGAAGGGGAGGCGGCGGTCGGAGAAGGCCCTGGGGAGAGCGAGGACGTGGAGGTGACAGGGGTGGACCCGCGCACAGTGGCAGAGGATACAGGGGCGGCTGGGGCGCAGATCGCGAGCGCGCTGAGCCTTCACAACCCAGAGTTGAGGGCAGAAATGAGGCTGTAGAACCCCAGGAAGAGGATGAACAGGTGTCGTCAGGATTCTCCAGGAGGAAAGTAACTTCCAACTGGGATCGCTATGAAGAAACTGAGAAGGAGCCTGAAAGTAAAGTGCTTCAAAGAGGAGCCGATTACAGTGTCCTCCTTAGTTCAGCAGGGGATTCCTTCACTCAGTTCAGATTTGCTGATGAGAAAGAATGGGAAGCAGAAAATCCAAGCCAAAAACAGGCCTCCGCTGTGTGTCTGGATCTCCAGTCTCTGGGGCGAGTCCTTCAGGAGCTGCCGCTGTATCTGCGACTCAACGTGGAGGCTGAGCTGGTTCAGGAAGCGTTACCGCAGGAGCTTCCTCATTTTAAGACCCAAGGCACTTTAAACTTGCCTCCAGTCACCCGTACCCCCACCAGTACTGCTGCAGTTGCTAATTCTACTCAGGTGGAAACGGGCCTTTCCCCAGGAACGGGTTTTTAAATGCCCAAAAGGGCTGCACACCACTTTTCCTCGCCTTGCTTTAGAATGAAAAATTTTGATTTTTTTGTTTTTCCCTGGGAACCCCCCGGGTGAAGGGAGGTTACCAGGGGGGTTCCCACCCGAAGGCATTTGA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGGGCCGCGGAAGACACAGAAGGGGAGGCGGCGGTCGGAGAAGGCCCTGGGGAGAGCGAGGACGTGGAGGTGACAGGGGTGGACCCGCGCACAGTGGCAGAGGATACAGGGGCGGCTGGGGCGCAGATCGCGAGCGCGCTGAGCCTTCACAACCCAGAGTTGAGGGCAGAAATGAGGCTGTAGAACCCCAGGAAGAGGATGAACAGGTGTCGTCAGGATTCTCCAGGAGGAAAGTAACTTCCAACTGGGATCGCTATGAAGAAACTGAGAAGGAGCCTGAAAGTAAAGTGCTTCAAAGAGGAGCCGATTACAGTGTCCTCCTTAGTTCAGCAGGGGATTCCTTCACTCAGTTCAGATTTGCTGATGAGAAAGAATGGGAAGCAGAAAATCCAAGCCAAAAACAGGCCTCCGCTGTGTGTCTGGATCTCCAGTCTCTGGGGCGAGTCCTTCAGGAGCTGCCGCTGTATCTGCGACTCAACGTGGAGGCTGAGCTGGTTCAGGAAGCGTTACCGCAGGAGCTTCCTCATTTTAAGACCCAAGGCACTTTAAACTTGCCTCCAGTCACCCGTACCCCCACCAGTACTGCTGCAGTTGCTAATTCTACTCAGGTGGAAACGGGCCTTTCCCCAGGAACGGGTTTTTAAATGCCCAAAAGGGCTGCACACCACTTTTCCTCGCCTTGCTTTAGAATGAAAAATTTTGATTTTTTTGTTTTTCCCTGGGAACCCCCCGGGTGAAGGGAGGTTACCAGGGGGGTTCCCACCCGAAGGCATTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCGGGGCCGCGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837803
dbEST ID: 79655505
Trimmed Sequence: AGAGATCATGCTGTCCAACCAATCTTCTAGATCTTCTTCAGTTACAGTTTTTTCCTTCTCATCGGAAGAAGTCGCAACATCTGTCACTGGAAGAGGTTCTTCACTCTTCTCATGAAGGTCACTCTCTTTATTTTCATTGCTCGGTTGGACGCCTGGTACCTCCTTCACTGGGGCTTCCAGGCTAAGCAGAAAGTCAAGTTCTTCATCTAATGCAAGCGGAGAAGAGTTGTGTGCAGCCTTTGTGGCATTTAAAACACGTTCCTGTGGAAGGGCCGTTTCCACTTGAGTAGAATTAGCCACTGCAGCAGTACTGGTTGGGGTACGGGTGACTGGAGGCAAGTTTAAAGTGCCTTTGGTCTTAAAATGAGGAAGCTCCTGCGGTAACGCTTCCTGAACCAGCTCAGCCTCCACGTTGAGTCGCAGATACAGCGGCAGCTCCTGAAGGACTCGCCCCAGAGACTGGAGATCCAGACACACAGCGGAGGCCTGTTTTTGGCTTGGATTTTCTGCTTCCCATTCTTTCTCATCAGCAAATCTGAACTGAGTGAAGGAATCCCCTGCTGAACTAAAGAGGACACTGTAATCGGCTCCTCTTTGAAACACTTTACTTTCAGGCTCCCTCTCAGTTTCTTCATAGCAAAGCCAGTTGGGAGTGTACTTTCCTCCTGGAGAAACCTGACGAAACCAGTTCATCCTCTTCCTGGGGGTCTACAACCCTCATTTCTGCCCCCAACTCCGGGGTTGGTGAAGGGGCAAGCGCGCTCCCGAGTCGGCGCCCGACCCGCCCCTGTATCCGCGGCCCCCTGTGGGCGGGTCCGCGCGCTTCCCCTGCCACATCCCCCCTCTCCCCCGGGGGCCTTCTGCAAACCCCCGCCCGCCCCTCTCTTGGCTTCCGGGGACCGCCGGCGGGGGTGCCAGGTTTTTTGTAGAAATTTGTGTCTTAAAAAAAAAACAATGCCTCCCCGGTTTGTTGCCGGGAACAGGGGGCCGGAGGGATGAAAAGAAAAACCAATATTTTTCCGGCCCCGAACTCGAAGGGGGGCCCGGGCATTTACGAAGGATGGCGGGCGCGGGGGAGGGGGGGGCGGGGGAGGAGGGAGAGGGGAGGAGGGAAAGAAAAGAAAAAGAAAAAAGAAAAAAAAAAAAAAAAAAAACAGAGAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAGAAAAA
Full Trace Sequence: GGGCAGGGAAACATNGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGAGATCATGCTGTCCAACCAATCTTCTAGATCTTCTTCAGTTACAGTTTTTTCCTTCTCATCGGAAGAAGTCGCAACATCTGTCACTGGAAGAGGTTCTTCACTCTTCTCATGAAGGTCACTCTCTTTATTTTCATTGCTCGGTTGGACGCCTGGTACCTCCTTCACTGGGGCTTCCAGGCTAAGCAGAAAGTCAAGTTCTTCATCTAATGCAAGCGGAGAAGAGTTGTGTGCAGCCTTTGTGGCATTTAAAACACGTTCCTGTGGAAGGGCCGTTTCCACTTGAGTAGAATTAGCCACTGCAGCAGTACTGGTTGGGGTACGGGTGACTGGAGGCAAGTTTAAAGTGCCTTTGGTCTTAAAATGAGGAAGCTCCTGCGGTAACGCTTCCTGAACCAGCTCAGCCTCCACGTTGAGTCGCAGATACAGCGGCAGCTCCTGAAGGACTCGCCCCAGAGACTGGAGATCCAGACACACAGCGGAGGCCTGTTTTTGGCTTGGATTTTCTGCTTCCCATTCTTTCTCATCAGCAAATCTGAACTGAGTGAAGGAATCCCCTGCTGAACTAAAGAGGACACTGTAATCGGCTCCTCTTTGAAACACTTTACTTTCAGGCTCCCTCTCAGTTTCTTCATAGCAAAGCCAGTTGGGAGTGTACTTTCCTCCTGGAGAAACCTGACGAAACCAGTTCATCCTCTTCCTGGGGGTCTACAACCCTCATTTCTGCCCCCAACTCCGGGGTTGGTGAAGGGGCAAGCGCGCTCCCGAGTCGGCGCCCGACCCGCCCCTGTATCCGCGGCCCCCTGTGGGCGGGTCCGCGCGCTTCCCCTGCCACATCCCCCCTCTCCCCCGGGGGCCTTCTGCAAACCCCCGCCCGCCCCTCTCTTGGCTTCCGGGGACCGCCGGCGGGGGTGCCAGGTTTTTTGTAGAAATTTGTGTCTTAAAAAAAAAACAATGCCTCCCCGGTTTGTTGCCGGGAACAGGGGGCCGGAGGGATGAAAAGAAAAACCAATATTTTTCCGGCCCCGAACTCGAAGGGGGGCCCGGGCATTTACGAAGGATGGCGGGCGCGGGGGAGGGGGGGGCGGGGGAGGAGGGAGAGGGGAGGAGGGAAAGAAAAGAAAAAGAAAAAAGAAAAAAAAAAAAAAAAAAAACAGAGAAAAAAAAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAAAAAAAAAGAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGATCATGCTGTCCAACCAA