ORFeome > awat1 ORF1 – XORFeome v1.0

awat1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: awat1
Gene ID: 5753347
Gene Page ID: 5753327
ORF Xenbase ID: 17265807

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC152706
Original XGC clone length: 966

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: F01

Sequences - 5ʹ (forward) EST

Accession: JZ839032
dbEST ID: 79656734
Trimmed Sequence: ATGCAGGTGCTCGCTGTACTCAAGTGGATCCTGACATTCCTATTTCTCGGCCCAGTTTGTGTTCTTTTAATCACTTGGATTTTCTGTAGCCAATTATGGCCTTTACTCGCATTGTACATGGTATGGCTGCTATCTGATTGGAAAACACCAGAGAGAGGTGGAAGAAAATCCGAGTGGATGAGCAAATGGACCATATGGAAACATTTAAGAGACTATTTCCCTATAAGGCTCCACAAAACAGCAAATCTGGATCCGCAACAAAATTACATCTTAGGATACCACCCTCATGGAATCATGAGCATTGGAGCATTCTGTAATTTTGGCACAGACCGTGCTGAATTTTCCCACTTGTTTCCTGGACTGAAACCATATCTTACCACTCTAGGTGGAAATTTCAAGGTGCCTTTTTACAGAGATTATCTGCTGGCTGCAGGGATGTGTTCAGTGACCCATTCATCCATAGACTACCTTATGTCCCATCATGGCACTGGAAATGCAGTGGTGATTGTAAGTGGGTGGTTCAGCAGAAGCATTGCATTGTAACGCTCAAAGCCATATCCTTACTCTAAAGAACAAAAAGGGCTTTGTAAAAAAGGCTCTCATTCATGGCTCATCCTTGGTTCCTGTATATTCATTCTGAGAGAATGAAGTTCTTCATCAATGCCACTTTGCAACCGGAAATTTGGAAAAAAGTCTTCAAAAAATTTTCCACCACTGGGTTTGAATTCGCTTCCTGGAATCTTCATTAGGCCAAGGGTTGGTTGGCCGGTAGGTTCGCAAGGAAATTTTCCCCTTTCCGGAAAACCCCCTCACCACCCTGAATATTTGAAAA
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGGTGCTCGCTGTACTCAAGTGGATCCTGACATTCCTATTTCTCGGCCCAGTTTGTGTTCTTTTAATCACTTGGATTTTCTGTAGCCAATTATGGCCTTTACTCGCATTGTACATGGTATGGCTGCTATCTGATTGGAAAACACCAGAGAGAGGTGGAAGAAAATCCGAGTGGATGAGCAAATGGACCATATGGAAACATTTAAGAGACTATTTCCCTATAAGGCTCCACAAAACAGCAAATCTGGATCCGCAACAAAATTACATCTTAGGATACCACCCTCATGGAATCATGAGCATTGGAGCATTCTGTAATTTTGGCACAGACCGTGCTGAATTTTCCCACTTGTTTCCTGGACTGAAACCATATCTTACCACTCTAGGTGGAAATTTCAAGGTGCCTTTTTACAGAGATTATCTGCTGGCTGCAGGGATGTGTTCAGTGACCCATTCATCCATAGACTACCTTATGTCCCATCATGGCACTGGAAATGCAGTGGTGATTGTAAGTGGGTGGTTCAGCAGAAGCATTGCATTGTAACGCTCAAAGCCATATCCTTACTCTAAAGAACAAAAAGGGCTTTGTAAAAAAGGCTCTCATTCATGGCTCATCCTTGGTTCCTGTATATTCATTCTGAGAGAATGAAGTTCTTCATCAATGCCACTTTGCAACCGGAAATTTGGAAAAAAGTCTTCAAAAAATTTTCCACCACTGGGTTTGAATTCGCTTCCTGGAATCTTCATTAGGCCAAGGGTTGGTTGGCCGGTAGGTTCGCAAGGAAATTTTCCCCTTTCCGGAAAACCCCCTCACCACCCTGAATATTTGAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGGTGCTCGCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839031
dbEST ID: 79656733
Trimmed Sequence: AAGTAGAATCAGAGAGTCGCTTTTCTGTAGGCCAAACCGTTCCTTGTGGGTATTGAAGAGTTCAAGTAGAGCACTGACATATAAAGCATGGTATTTCTGTACTTGCTCATCCGAGGGTTTCTGTATTCTAGGCACAGGGATGGGCTTTCCAACAACAGTGTTGATGGGCTTCCGGAAGGGCAATATTCCTTTGGAAGTACTGGAGAACAACCCTTGCCCATAGAAGATACAGGGAGCGAATCCAACCCAGTGTTGGAACATGTCTTGAAGACTTTTTTTCCAACTTCCTGTTGCAAAGTGGCATTGATGAAGAACTTCATTCTCTCCGAATGAATATACAGGAACCAAGGATGAGCCATGAGTGAGAGCCTTTTTTACAAAGCCCTTTCTGTTCTTTAGAGTAAGGATATGGCTTTGAGCGTTACAATGCAATGCTTCTGCTGAACCACGCACTACAATCACCACTGCATTGCGTGTGCCAGTGGATGGGACATAGAGTAGTCGATGGAAGAATGGGTCACTGAACACCTCCCCGGCAGCCGGCCATAATCTCTGTAAAAAGGCACCTGGGAAATTTCGCCTAGAATGGGTAGGAGGGGGTTGGAGTCCCGGGAAAAAGTGGAGAAAAATCAGCAAAGGTCTGGGCCGAAATTAGCAAAAGTGCGCCAAGGCTCCGTGATTCCGTGAGGGGGGGGGTTAGGGAGGGAAAGAAAATTTTTTTTGGCGAAGGGGGGAATTTGGCTGGTGTTTTGTGGAACCCTTGGTGGGGGGA
Full Trace Sequence: CGGGAAACTGCTATAGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTAGAATCAGAGAGTCGCTTTTCTGTAGGCCAAACCGTTCCTTGTGGGTATTGAAGAGTTCAAGTAGAGCACTGACATATAAAGCATGGTATTTCTGTACTTGCTCATCCGAGGGTTTCTGTATTCTAGGCACAGGGATGGGCTTTCCAACAACAGTGTTGATGGGCTTCCGGAAGGGCAATATTCCTTTGGAAGTACTGGAGAACAACCCTTGCCCATAGAAGATACAGGGAGCGAATCCAACCCAGTGTTGGAACATGTCTTGAAGACTTTTTTTCCAACTTCCTGTTGCAAAGTGGCATTGATGAAGAACTTCATTCTCTCCGAATGAATATACAGGAACCAAGGATGAGCCATGAGTGAGAGCCTTTTTTACAAAGCCCTTTCTGTTCTTTAGAGTAAGGATATGGCTTTGAGCGTTACAATGCAATGCTTCTGCTGAACCACGCACTACAATCACCACTGCATTGCGTGTGCCAGTGGATGGGACATAGAGTAGTCGATGGAAGAATGGGTCACTGAACACCTCCCCGGCAGCCGGCCATAATCTCTGTAAAAAGGCACCTGGGAAATTTCGCCTAGAATGGGTAGGAGGGGGTTGGAGTCCCGGGAAAAAGTGGAGAAAAATCAGCAAAGGTCTGGGCCGAAATTAGCAAAAGTGCGCCAAGGCTCCGTGATTCCGTGAGGGGGGGGGTTAGGGAGGGAAAGAAAATTTTTTTTGGCGAAGGGGGGAATTTGGCTGGTGTTTTGTGGAACCCTTGGTGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTAGAATCAGAGAGTCGCTTT