ORFeome > b4galt7 ORF1 – XORFeome v1.0

b4galt7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: b4galt7
Gene ID: 973276
Gene Page ID: 973271
ORF Xenbase ID: 17265903

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084833
Original XGC clone length: 972

Human orthology & disease relationships

NCBI Entrez ID: 11285
Ensembl gene IDs: ENSG00000027847
Directly associated (OMIM) disease MIM numbers: 130070
Indirectly associated (Lage, et al.) disease MIM numbers: 130070

Library Location

Plate ID: GDExl11006
Well Location: C03

Sequences - 5ʹ (forward) EST

Accession: JZ840032
dbEST ID: 79657734
Trimmed Sequence: ATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCGGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAACAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCGGAGCTGCCCCACTTTATCATTAGCAGACATATGTGGGAAGGAGCTTGCGGCTCACCAGCAACATTAGGAATGTGCAATGGAATGTCCATTCATTTCTGGGATGGGGTGGGGGAGATGAAAAATTGTTACGAAGGGTAAAAAGGAACGGAAGTTGAAGTCCTTTCCTTCCGAACGTGAGAAAGCGGCGGGGATCAGAAAACGTTTCGATTACATAACACGGCCCCCCCTGACGGGGGGAAGAAAGCGGA
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATATGACACGGAGAAAGCCAGCTCTGTACCTCAGAGAGGACAGCAGATCAAGCTTGTTTTTGGGGTTTCTGCCTCGGAAATGCAGCATTTTTAATTTGTTCCTGACTTGCTTGATCCTGGGTTTTCTATCTATGCTCTGGTTGCAACTCAGCTGTACTGGTGGTGATGTGAACAAGAGAGCAATTCAGGATGAAGTCTCTTCTCAGAAGTCCTGCCCCCAGATTCCTAGGACTGTGAATGAAGATCCCTCATGGGGTCCTCACCGGCTTGCTTTGCTGATCCCTTTTCGGGAGCGATTTGAAGAACTTATGAGCTTTGTTCCTCATATGCATCGGTACTTGATACAGAAAAAAATCCTTCATCATATTTTCATCATCAATCAAGTGGATCATTTTCGATTTAATAGAGCTTCTCTGATTAATGTGGGCTTCCTGGAGAGCGGGAATGAAACGGATTACATAACAATGCATGATGTGGACCTGTTGCCTCTTAACCTTGATTTGGATTATGGCTTCCCGGATAAGGGACCGTTCCACGTGGCCTCCCCGGAGCTGCCCCACTTTATCATTAGCAGACATATGTGGGAAGGAGCTTGCGGCTCACCAGCAACATTAGGAATGTGCAATGGAATGTCCATTCATTTCTGGGATGGGGTGGGGGAGATGAAAAATTGTTACGAAGGGTAAAAAGGAACGGAAGTTGAAGTCCTTTCCTTCCGAACGTGAGAAAGCGGCGGGGATCAGAAAACGTTTCGATTACATAACACGGCCCCCCCTGACGGGGGGAAGAAAGCGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATATGACACGGAGAAAGCCA

Sequences - 3ʹ (reverse) EST

Accession: JZ840031
dbEST ID: 79657733
Trimmed Sequence: GTTAAAGACACACCATGGTGTGTGCCCCAAGTCACATTCCAGGAGAACATTCAGTACTGTGCAAGGGGCTCCACTGATGGTGACCTCTGACCTTGATTCCACACGATACTTAACACTGTGCAAACCTCCTGCCCGATCCACTTTAAACTGCTCCTGCTTCTGAGCAGCAATCCTCTTCTGGTCTCGCTTCCTCCATGCAGGGTCATGTATGTGACGGAAAGTTTTGTATCCTGTGCTTATTCCTGTCGGACGAAAGAGCTCTAGTTCAGCTCCTTTTATCCTTCTGTAAAACTCGTCATCTTCCCTACCCCATCCCCAGAATCGATTGGACATTCCATTGCACATTTCATAATGCTGTTTGGTGAGCAGCACAATCCCTCCCACATATGTCTTGTAATGATAAAGTGGGTGCAGCTCTGGGGAGGCCACGTGGAACGGTCCCTTATCCGGGAAGCCATAATCCAAATCAAGGTTAAGAGGCAACAGGTCCACATCATGCATTGCTATGTAATCCGTTTCATTCCCGCTCTCCAGGAAACCCACATTAATCAGAGAAACTCTATTAAATCGAAAATGATCCACTTGAATGATGATGAAGATATTATGAAAGAATTTTTTCCGGACCAAGTACCGATGCCTATTAAGGAACAAAGCCTCAAAGTTCCTTAAATCGCCCCCCAAAAAGGAATCAACCAAAGCAAGCCCGGTTAAGGACCCCCCTGAGGGGATCCTCTCATTCAAAATTCCCAAGGAAATTCCGGGGGGGCCAGGAAATTTCC
Full Trace Sequence: GAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTAAAGACACACCATGGTGTGTGCCCCAAGTCACATTCCAGGAGAACATTCAGTACTGTGCAAGGGGCTCCACTGATGGTGACCTCTGACCTTGATTCCACACGATACTTAACACTGTGCAAACCTCCTGCCCGATCCACTTTAAACTGCTCCTGCTTCTGAGCAGCAATCCTCTTCTGGTCTCGCTTCCTCCATGCAGGGTCATGTATGTGACGGAAAGTTTTGTATCCTGTGCTTATTCCTGTCGGACGAAAGAGCTCTAGTTCAGCTCCTTTTATCCTTCTGTAAAACTCGTCATCTTCCCTACCCCATCCCCAGAATCGATTGGACATTCCATTGCACATTTCATAATGCTGTTTGGTGAGCAGCACAATCCCTCCCACATATGTCTTGTAATGATAAAGTGGGTGCAGCTCTGGGGAGGCCACGTGGAACGGTCCCTTATCCGGGAAGCCATAATCCAAATCAAGGTTAAGAGGCAACAGGTCCACATCATGCATTGCTATGTAATCCGTTTCATTCCCGCTCTCCAGGAAACCCACATTAATCAGAGAAACTCTATTAAATCGAAAATGATCCACTTGAATGATGATGAAGATATTATGAAAGAATTTTTTCCGGACCAAGTACCGATGCCTATTAAGGAACAAAGCCTCAAAGTTCCTTAAATCGCCCCCCAAAAAGGAATCAACCAAAGCAAGCCCGGTTAAGGACCCCCCTGAGGGGATCCTCTCATTCAAAATTCCCAAGGAAATTCCGGGGGGGCCAGGAAATTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTAAAGACACACCATGGTGTGTG