ORFeome > bak1 ORF1 – XORFeome v1.0

bak1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bak1
Gene ID: 962901
Gene Page ID: 962897
ORF Xenbase ID: 17265969

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC099018
Original XGC clone length: 678

Human orthology & disease relationships

NCBI Entrez ID: 578
Ensembl gene IDs: ENSG00000030110
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,123400,124200,133239,137440,151623,211980,228600,236490,260500,275355,601859,603218,607271,607822

Library Location

Plate ID: GDExl11089
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ838371
dbEST ID: 79656073
Trimmed Sequence: ATGATCTCTTCCGCATGTGAAGTAGAGTTTTCATACCGAAATAGTGCACTGAAGGTATCTGGCCTTCTAATGGCAGCTAAAGACGAGCAAGAGTCAGACCAATTGCAAAAATCTGATGTTGAAGAGGTCACACAGCAAACTGAGATTGTTTTTCAAAGTTACTCCTTTCATCGTCTGCAACTTGAAAGGGATCAGAATGAATACTCTCCTGTCCTGGATGAAGAAATTGTGGAGCCCCAGCAGTCAGAAAGTGCAAACCTTATCAGTGTTGGCCAGCAGTTAGCAAAGATTGGTGATGATATTAATGAGCGTTATCAAGAACAATTTGATAACATTCTGAAGAATCTGAACCCCAGTCTAGACAATGCTTACTCATACTTCAAGAAGATAGCATCCAGTCTGTTTGAGAATGGAATAAACTGGGGCCGTATTTTGTCACTGCTTGGTTTTGGATATCGAATGGCAGTTTATGTTGTCAGGAATGGGCAGCGAGGATTTTTCAGAATAATAAATCAGTGGATGATGACATATGTTATGGAGAGCTGTGTTGCACAATGGATATCAGACAGAGGAGGTTGGGCGGCATTCTTCCAATTAACAAATTACAGTATAAAATATGTCATCGTGGCTCTCAGTGTGGCACTTACCCTGCAGTTTCTGCTTCACCAAATGACCTTTGCCAACTTTTGTTGTTCAATTTTGGCAATTATAGAAAAGCATTTGCTTATCAGTTTGTTGC
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATCTCTTCCGCATGTGAAGTAGAGTTTTCATACCGAAATAGTGCACTGAAGGTATCTGGCCTTCTAATGGCAGCTAAAGACGAGCAAGAGTCAGACCAATTGCAAAAATCTGATGTTGAAGAGGTCACACAGCAAACTGAGATTGTTTTTCAAAGTTACTCCTTTCATCGTCTGCAACTTGAAAGGGATCAGAATGAATACTCTCCTGTCCTGGATGAAGAAATTGTGGAGCCCCAGCAGTCAGAAAGTGCAAACCTTATCAGTGTTGGCCAGCAGTTAGCAAAGATTGGTGATGATATTAATGAGCGTTATCAAGAACAATTTGATAACATTCTGAAGAATCTGAACCCCAGTCTAGACAATGCTTACTCATACTTCAAGAAGATAGCATCCAGTCTGTTTGAGAATGGAATAAACTGGGGCCGTATTTTGTCACTGCTTGGTTTTGGATATCGAATGGCAGTTTATGTTGTCAGGAATGGGCAGCGAGGATTTTTCAGAATAATAAATCAGTGGATGATGACATATGTTATGGAGAGCTGTGTTGCACAATGGATATCAGACAGAGGAGGTTGGGCGGCATTCTTCCAATTAACAAATTACAGTATAAAATATGTCATCGTGGCTCTCAGTGTGGCACTTACCCTGCAGTTTCTGCTTCACCAAATGACCTTTGCCAACTTTTGTTGTTCAATTTTGGCAATTATAGAAAAGCATTTGCTTATCAGTTTGTTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCTCTTCCGCATGTGAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838370
dbEST ID: 79656072
Trimmed Sequence: GGTCAATCGTTGAAGCAGAAACTGCAGGGTAAGTGCCACACTGAGAGCCACGATGACATATTTTATACTGTAATTTGTTAATTGGAAGAATGCCGCCCAACCTCCTCTGTCTGATATCCATTGTGCAACACAGCTCTCCATAACATATGTCATCATCCACTGATTTATTATTCTGAAAAATCCTCGCTGCCCATTCCTGACAACATAAACTGCCATTCGATATCCAAAACCAAGCAGTGACAAAATACGGCCCCAGTTTATTCCATTCTCAAACAGACTGGATGCTATCTTCTTGAAGTATGAGTAAGCATTGTCTAGACTGGGGTTCAGATTCTTCAGAATGTTATCAAATTGTTCTTGATAACGCTCATTAATATCATCACCAATCTTTGCTAACTGCTGGCCAACACTGATAAGGTTTGCACTTTCTGACTGCTGGGGCTCCACAATTTCTTCATCCAGGACAGGAGAGTATTCATTCTGATCCCTTTCCAGTTGCAGACGATGAAAGGGAGTAACTTTGAAAAACAATCTCAGTTTGCTGTGTGACCCCCTTCACAGCAGATTTTTGCAGTTGGTCTGACTCTTGGCCCGCTTGGGCCTCCCTTAGAAAAGCCAGATACCTGTCGTGCCTGGTGTGGGTATGAGGAGGCAAGGGCGGATTCTTAAAAAAAACGTAGAAACCGAGCGTTGTTGGGAAAAAAATTGGGGGGAAAA
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTCAATCGTTGAAGCAGAAACTGCAGGGTAAGTGCCACACTGAGAGCCACGATGACATATTTTATACTGTAATTTGTTAATTGGAAGAATGCCGCCCAACCTCCTCTGTCTGATATCCATTGTGCAACACAGCTCTCCATAACATATGTCATCATCCACTGATTTATTATTCTGAAAAATCCTCGCTGCCCATTCCTGACAACATAAACTGCCATTCGATATCCAAAACCAAGCAGTGACAAAATACGGCCCCAGTTTATTCCATTCTCAAACAGACTGGATGCTATCTTCTTGAAGTATGAGTAAGCATTGTCTAGACTGGGGTTCAGATTCTTCAGAATGTTATCAAATTGTTCTTGATAACGCTCATTAATATCATCACCAATCTTTGCTAACTGCTGGCCAACACTGATAAGGTTTGCACTTTCTGACTGCTGGGGCTCCACAATTTCTTCATCCAGGACAGGAGAGTATTCATTCTGATCCCTTTCCAGTTGCAGACGATGAAAGGGAGTAACTTTGAAAAACAATCTCAGTTTGCTGTGTGACCCCCTTCACAGCAGATTTTTGCAGTTGGTCTGACTCTTGGCCCGCTTGGGCCTCCCTTAGAAAAGCCAGATACCTGTCGTGCCTGGTGTGGGTATGAGGAGGCAAGGGCGGATTCTTAAAAAAAACGTAGAAACCGAGCGTTGTTGGGAAAAAAATTGGGGGGAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTCAATCGTTGAAGCAG