ORFeome > banf1 ORF1 – XORFeome v1.0

banf1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: banf1
Gene ID: 6254337
Gene Page ID: 5745249
ORF Xenbase ID: 17265981

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078546
Original XGC clone length: 273

Human orthology & disease relationships

NCBI Entrez ID: 8815
Ensembl gene IDs: ENSG00000175334
Directly associated (OMIM) disease MIM numbers: 614008
Indirectly associated (Lage, et al.) disease MIM numbers: 310300

Library Location

Plate ID: GDExl11004
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ839600
dbEST ID: 79657302
Trimmed Sequence: ATGTCATCAACATCCCAAAAACACAGAGACTTTGTGGCAGAGCCAATGGGAGAAAAGTCAGTCCAATGTCTGGCAGGTATTGGTGACACATTGGGGCGCAGGCTTGAGGAAAAAGGGTTTGATAAGGCTTATGTGGTGTTGGGTCAGTTTCTTGTTTTGAAGAAGGATGAAGAGCTTTTCAAGGAGTGGCTGAAAGATGCCTGTTCTGCCAATGCCAAGCAGTCTAGAGATTGTTACGGCTGCCTAAAAGAATGGTGTGATGCCTTTTTGTT
Full Trace Sequence: GGGGTCTTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATCAACATCCCAAAAACACAGAGACTTTGTGGCAGAGCCAATGGGAGAAAAGTCAGTCCAATGTCTGGCAGGTATTGGTGACACATTGGGGCGCAGGCTTGAGGAAAAAGGGTTTGATAAGGCTTATGTGGTGTTGGGTCAGTTTCTTGTTTTGAAGAAGGATGAAGAGCTTTTCAAGGAGTGGCTGAAAGATGCCTGTTCTGCCAATGCCAAGCAGTCTAGAGATTGTTACGGCTGCCTAAAAGAATGGTGTGATGCCTTTTTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCCGATATCCCGGATAGTGAATCATATTACATGGTCATAGCTGTTTCCTGGCAGCTCTCGCCAAAAAAAAAAATCATATTAATTACATAAAGATGCCGTGAGCCTAAAAAAAAAAAAAAAAAAATACTCTTCACTTGCCTCTCTAAGTGTATGTTTTTTATAATAGAGTAATGTTCTCAACACAAAATAAAAGAGGTGGTTCGTGCTTTTTTTAAAAAAACTTAGAATGTCACTAAAATGGGGTACATTAAATATTTCTTTTATGGAATTTTGGTCGGGGGGATGGTTTTCTGTGTTTTCATTTTTGATTTTTTTTAAAATTTTTTTCAATTAATGACCACGGGGGGCCTCATCTCTTTGTGGGGCCGTTTTTTTTTCGGCTTATATCTTATAAAAAAGTTTTTTTTTTTTTGTGGCCCCCCATAAATTAAATTTCCTGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATCAACATCCCAAAAACAC

Sequences - 3ʹ (reverse) EST

Accession: JZ839599
dbEST ID: 79657301
Trimmed Sequence: CAAAAAGGCATCACACCATTCTTTTAGGCAGCCGTAACAATCTCTAGACTGCTTGGCATTGGCAGAACAGGCATCTTTCAGCCACTCCTTGAAAAGCTCTTCATCCTTCTTCAAAACAAGAAACTGACCCAACACCACATAAGCCTTATCAAACCCTTTTTCCTCAAGCCTGCGCCCCAATGTGTCACCAATACCTGCCAGACATTGGACTGACTTTTCTCCCATTGGCTCTGCCACAAAGTCTCTGTGTTTTTGGGATGTTGATGACATGG
Full Trace Sequence: AAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAAAGGCATCACACCATTCTTTTAGGCAGCCGTAACAATCTCTAGACTGCTTGGCATTGGCAGAACAGGCATCTTTCAGCCACTCCTTGAAAAGCTCTTCATCCTTCTTCAAAACAAGAAACTGACCCAACACCACATAAGCCTTATCAAACCCTTTTTCCTCAAGCCTGCGCCCCAATGTGTCACCAATACCTGCCAGACATTGGACTGACTTTTCTCCCATTGGCTCTGCCACAAAGTCTCTGTGTTTTTGGGATGTTGATGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTGGCCAACGTTTTACAACAAGATGAACTGAGAAAATAAGGGAACGGCCGGGAAAAAAAAAAAGGAAAAGATATTACCGGAAAAGGGGGCGTTCTTGGGTTGTTTGTTTTTGAGGGGAGGAACTCCAGAAACACAAAAGGGCCCTCGCAGTTTTTTCGGATGTTTGGAGAGAGAAACGAATCCCGGGGAAAAGAAAAACAAACCCGGTGGAGAAAATATAGAAGTTGGTGGGGCGAGAGGGGGTTTTGGGAGGGTGGTAGAGTGTTTTTAAAGGGTGTTTTTTTCCTCCTTGCGTTTACACAAACAACCCTTTTCCCCCGGGCGGTGTATTCTTGGTTGTTGTTGAGATAACAAATTTTAAGTACACAAACAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAAAGGCATCACACCATTC