ORFeome > basp1 ORF1 – XORFeome v1.0

basp1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: basp1
Gene ID: 6254995
Gene Page ID: 6258617
ORF Xenbase ID: 17266005

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106640
Original XGC clone length: 711

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ837650
dbEST ID: 79655352
Trimmed Sequence: ATGGGAGGAAAGCTGAGCAAGAAGAAGAAGGGATATAATGTAAATGATGACAAAACAAAAGATAAAGACAAAAAGGCAGAGGGAGCTAATACAGAGGAAGAAGTGGCACCTAAAGCAAATGAAGACACTCAGCCTACTGTAGATATTACAGAAGTAAAAGAAAATGATGCAAAGAATGATAAGGATGCCAAGGCAACAGAAAGCAAAACAGAAAATAACGAAGGAGAAAAAGAGGCACCAAACAAAGATGTTGTGCAAAAACCAGAGTCAGAAAAAACAGAAGCTTCTTCTGATGCTAAAGCAGAGTCACAGAAAACTGAACAGCCAGTATCAAAGCCAGAGGATCAACCAGCAGCAGCCCCTGCCCCTGTTACTAACAATGAAGGGCCAAAGACCTCTGAGCCCAGTACTGAGGCCAAAGTTTCCCAGCCTTCAGAAGCACCAGCACCAAGTAAAGTAGAGGAAAAGAGTAAAGAGGAAGGGGAAGCCAAAAAGACTGAGGCTCCCGCTTCATCAGAAATCAAAAATGAGTCCGCCCCAGCTTCAGACTCANAACCTAGCAGTGAAGCCACTCCTTCTGTGAAGTCTCAAGAAACTGAAGCACCTAGTTCTACTACTAAGGCCTTTGAGCCTGCAGGACCAGCTGATGAAGTTAAAGCTTTGGAGATCCCAGCAGCTAATTCTGATCAAACCGTAGCAGTTCAAGAGTT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAGGAAAGCTGAGCAAGAAGAAGAAGGGATATAATGTAAATGATGACAAAACAAAAGATAAAGACAAAAAGGCAGAGGGAGCTAATACAGAGGAAGAAGTGGCACCTAAAGCAAATGAAGACACTCAGCCTACTGTAGATATTACAGAAGTAAAAGAAAATGATGCAAAGAATGATAAGGATGCCAAGGCAACAGAAAGCAAAACAGAAAATAACGAAGGAGAAAAAGAGGCACCAAACAAAGATGTTGTGCAAAAACCAGAGTCAGAAAAAACAGAAGCTTCTTCTGATGCTAAAGCAGAGTCACAGAAAACTGAACAGCCAGTATCAAAGCCAGAGGATCAACCAGCAGCAGCCCCTGCCCCTGTTACTAACAATGAAGGGCCAAAGACCTCTGAGCCCAGTACTGAGGCCAAAGTTTCCCAGCCTTCAGAAGCACCAGCACCAAGTAAAGTAGAGGAAAAGAGTAAAGAGGAAGGGGAAGCCAAAAAGACTGAGGCTCCCGCTTCATCAGAAATCAAAAATGAGTCCGCCCCAGCTTCAGACTCANAACCTAGCAGTGAAGCCACTCCTTCTGTGAAGTCTCAAGAAACTGAAGCACCTAGTTCTACTACTAAGGCCTTTGAGCCTGCAGGACCAGCTGATGAAGTTAAAGCTTTGGAGATCCCAGCAGCTAATTCTGATCAAACCGTAGCAGTTCAAGAGTTGCCAACTTTCTTGTACAAAGTTTGGCATTTATAAGAAAGCATTGCTTTATCAATT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGGAAAGCTGAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837649
dbEST ID: 79655351
Trimmed Sequence: CTCTTGAACTGCTACGGTTTGATCAGAATTAGCTGCTGGGATCTCCAAAGCTTTAACTTCATCAGCTGGTCCTGCAGGCTCAAAGGCCTTAGTAGTAGAACTAGGTGCTTCAGTTTCTTGAGACTTCACAGAAGGAGTGGCTTCACTGCTAGGTTTTGAGTCTGAAGCTGGGGCGGACTCATTTTTGATTTCTGATGAAGCGGGAGCCTCAGTCTTTTTGGCTTCCCCTTCCTCTTTACTCTTTTCCTCTACTTTACTTGGTGCTGGTGCTTCTGAAGGCTGGGAAACTTTGGCCTCAGTACTGGGCTCAGAGGTCTTTGGCCCTTCATTGTTAGTAACAGGGGCAGGGGCTGCTGCTGGTTGATCCTCTGGCTTTGATACTGGCTGTTCAGTTTTCTGTGACTCTGCTTTAGCATCAGAAGAAGCTTCTGTTTTTTCTGACTCTGGTTTTTGCACAACATCTTTGTTTGGTGCCTCTTTTTCTCCTTCGTTATTTTCTGTTTTGCTTTCTGTTGCCTTGGCGTCCTTATCATTCTTTGCATCATTTTCTTTTACTTCTGTAATATCTACAGTAGGCTGAGTGTCTTCGTTTGCTTTATGTGCCACTTCTTCCTCCGTATTAGCTCCCTCGGCCGTTTTGTCTTGAGCTTTTGTTTTGTCGGCAATTACATTAAATCCCTTCTTCGTCGTGCGGGGCTTTCCGCCGGGGGGGGCCAGGTGTTTTTACAAATTTGGGCTTATAAAAATGGGTGCGCGTCAATTGGTTGCAGCGAGCGGGTGGTATGGGAAAAAAAAGAAAAAAAAATTAGAGAAAAAAAAAAAAACGGGAGGTGCGTTGAAAACGGCGGGGGTGGCCGGCCCAAGAAGAGGGGGGGGGGCGGCGCGGGGGGGGAGGGTTGTTTTTTTTGGTTTGTGGGGGGCGGGGGTGGGGTGTGATAAAGGAAGAAAAGAGGGGGACACCTAGAAGGAGGAAGAAGGGCGAGGGAGGGGGGGGGGANAGGGAAAAGAAGAAATTTTAAAATAATGATAAAGATATTAATGTGTTTTTCGTAGGGAGAAGAAGAAAAAAACACAACCCCCCCTCCGCCCGGTGTGAGAAGAAAACAAGGAGGGGAGGGGAGAAGGGGAGACAGGGGGGGAGGGGGGGGAGAGAGAGAAAAAGAAAAAGAAGAAAAAGAAAAAAGCGAAGAGGGGGCGGACGGNGGGAGGGGGAGATAAGATGGAGG
Full Trace Sequence: GTGCAGGGTAACAGCCATTGAACCATGGAAAACGACTCACTATACGGGGAAACCAGCCCGGAGGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCTTGAACTGCTACGGTTTGATCAGAATTAGCTGCTGGGATCTCCAAAGCTTTAACTTCATCAGCTGGTCCTGCAGGCTCAAAGGCCTTAGTAGTAGAACTAGGTGCTTCAGTTTCTTGAGACTTCACAGAAGGAGTGGCTTCACTGCTAGGTTTTGAGTCTGAAGCTGGGGCGGACTCATTTTTGATTTCTGATGAAGCGGGAGCCTCAGTCTTTTTGGCTTCCCCTTCCTCTTTACTCTTTTCCTCTACTTTACTTGGTGCTGGTGCTTCTGAAGGCTGGGAAACTTTGGCCTCAGTACTGGGCTCAGAGGTCTTTGGCCCTTCATTGTTAGTAACAGGGGCAGGGGCTGCTGCTGGTTGATCCTCTGGCTTTGATACTGGCTGTTCAGTTTTCTGTGACTCTGCTTTAGCATCAGAAGAAGCTTCTGTTTTTTCTGACTCTGGTTTTTGCACAACATCTTTGTTTGGTGCCTCTTTTTCTCCTTCGTTATTTTCTGTTTTGCTTTCTGTTGCCTTGGCGTCCTTATCATTCTTTGCATCATTTTCTTTTACTTCTGTAATATCTACAGTAGGCTGAGTGTCTTCGTTTGCTTTATGTGCCACTTCTTCCTCCGTATTAGCTCCCTCGGCCGTTTTGTCTTGAGCTTTTGTTTTGTCGGCAATTACATTAAATCCCTTCTTCGTCGTGCGGGGCTTTCCGCCGGGGGGGGCCAGGTGTTTTTACAAATTTGGGCTTATAAAAATGGGTGCGCGTCAATTGGTTGCAGCGAGCGGGTGGTATGGGAAAAAAAAGAAAAAAAAATTAGAGAAAAAAAAAAAAACGGGAGGTGCGTTGAAAACGGCGGGGGTGGCCGGCCCAAGAAGAGGGGGGGGGGCGGCGCGGGGGGGGAGGGTTGTTTTTTTTGGTTTGTGGGGGGCGGGGGTGGGGTGTGATAAAGGAAGAAAAGAGGGGGACACCTAGAAGGAGGAAGAAGGGCGAGGGAGGGGGGGGGGANAGGGAAAAGAAGAAATTTTAAAATAATGATAAAGATATTAATGTGTTTTTCGTAGGGAGAAGAAGAAAAAAACACAACCCCCCCTCCGCCCGGTGTGAGAAGAAAACAAGGAGGGGAGGGGAGAAGGGGAGACAGGGGGGGAGGGGGGGGAGAGAGAGAAAAAGAAAAAGAAGAAAAAGAAAAAAGCGAAGAGGGGGCGGACGGNGGGAGGGGGAGATAAGATGGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCTTGAACTGCTACGGTTT