ORFeome > batf ORF1 – XORFeome v1.0

batf ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: batf
Gene ID: 6255842
Gene Page ID: 6258075
ORF Xenbase ID: 17266011

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129757
Original XGC clone length: 348

Human orthology & disease relationships

NCBI Entrez ID: 10538
Ensembl gene IDs: ENSG00000156127
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,259500,300367

Library Location

Plate ID: GDExl11086
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ837849
dbEST ID: 79655551
Trimmed Sequence: ATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAAAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAAACTCATTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTT
Full Trace Sequence: CTCGGGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAACAAGAGTCTGACAGAAATGAGCAGGGCTACAGCAGCTCCCCCCCTTCTAGCAATAAACAGGACTCTTCAGATGACACAAAGAAAAATCACAGAAAAGAGAAAAATAGGATTGCAGCACAGAAAAGCCGCCAGCGACAAACAGAAAAAGCAAACTCATTGCACATTGAGAGTGAGAATTTGGAGCGCCTGAATTCGGCATTACGCGGAGAAATCAGTGGCCTGCGAGAGGAACTGAAATATCTCACATGTGTGCTAAGTACCCACCAACCTGTTTGTGTCCTTGGTCCAACAAAGCCACAAGCTATCCTCCCACATGTCGGATCCACCCGCTACCAGCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAGAACAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCATTCAAAATAAAATCATTATTTGCCGTCCAGCTGATATCCCCTAATAGTGAGTCGTATTACATGGTCATTAGCTGTTTCCTGGCAGCTCTAAAAAAAAAAAAAAAAATAATATTAATTAATAACCCCAAGTAACGAGGGGGGGGGGGGTGGGGGAAAAAATACTGCGTCACTCGGGGGGGGGGGGGGGGTGGTCGCCTGTATGGGGAGGGGGGGGGAGAGTCCGCCGCGAACAACACGTCGCGCGTTGCGGGGGTGGAGGATGAAGAGAAAATCACCCCGCCCCCAGAAAGCTGAGGAGGGGTTGAAGAAGGGGGGTGAGGAGTGGCGTCGGGATGATATGGTACGGNTGATGTGGAGAAGTAGTAGANNNAGTAGGGGGGCAGGGCTGCGGNCGGACAACAGGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAACAAGAGTCTGACAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837848
dbEST ID: 79655550
Trimmed Sequence: GTGCTGGTAGCGGGTGGATCCGACATGTGGGAGGATAGCTTGTGGCTTTGTTGGACCAAGGACACAAACAGGTTGGTGGGTACTTAGCACACATGTGAGATATTTCAATTCCTCTCGCAAGCCACTGATTTCTCCGCGTAATGCCGAATTCAGGCGCTCCAAATTCTCACTCTCAATGTGCAATGAGTCTGCTTTTTCTGTTTGTCGCTGGCGGCTTTTCTATGCTGCGATCCTATTTTTCTCTCTTCTGTGATTTTTCTTTGTGTCATCTGAACAAACCTGTTTATTGCTAGAAGGGGGGGAGCTACTGTACCCCTGCTCATTTCTGTGGAACTCTTGTTGGAGCGTGCCGACTTTTTCGAGGATTCTT
Full Trace Sequence: GGGGCGGGAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCTGGTAGCGGGTGGATCCGACATGTGGGAGGATAGCTTGTGGCTTTGTTGGACCAAGGACACAAACAGGTTGGTGGGTACTTAGCACACATGTGAGATATTTCAATTCCTCTCGCAAGCCACTGATTTCTCCGCGTAATGCCGAATTCAGGCGCTCCAAATTCTCACTCTCAATGTGCAATGAGTCTGCTTTTTCTGTTTGTCGCTGGCGGCTTTTCTATGCTGCGATCCTATTTTTCTCTCTTCTGTGATTTTTCTTTGTGTCATCTGAACAAACCTGTTTATTGCTAGAAGGGGGGGAGCTACTGTACCCCTGCTCATTTCTGTGGAACTCTTGTTGGAGCGTGCCGACTTTTTCGAGGATTCTTGGCATTAGAAAAAAGCATTGCTCATCAATTGGTTCCGACNAACANNTGACTATCAATGAAAAAATAATCATTATTTNNNGCCCGAACTTANNAAAAAAAAAAAAAAAAAAAAATATTCATATAACTCCCCCCAAAGGAACGGGCGAAAAAAAGAAAAAAATAAGGCTGCCCCAAGGAGGGGGGGGGAGTGTTCCCTGTATTTGTGGTAAGGAAGAAACGAGCCAGGAAACACGGCCGGGCCCTAATTATATGGTAGGGAGAAAGACGCGACACCCCCCTCNAAGACACTGGGNGGAGAGGAGGGGGAGGGGGNNGGGGGGGGGNGNTATNNNNGNGGNNGGGGGTNNNNNNGNNNNNNGNNNGNGGNGNGNNNGGGNNGGNGGNGGGNGNGGGNGGGGGGGGGGGNNGNNNGNNGGNNNNNGGGNNNGGNGGNNNGNNNAGGNGGGGGGGGNGNGGNNNNGGGGGGGGGGGNGGGNNGNGGNGAGNGGANNNNNGNNNGGGGGNNNNGNGGGNNNGNNNGNNGNNNGNNGGNNGNNNNNNNNNNNGNNGNNNNNGNGGGNNANGGNNNTAAGNGNNNGNNGNTNNNNNTTNGGNGGNGGNGGGNGNNNNNNNNANAGGNNGGGGANNNAAGGANNAGCNGNNNNNNGGGNNNNAGGGNANGGNGGGAAGTNAAGGAAGGGGGGNNNNNAGGNNGNNAGANNANNNNNNNNNNGAANNGGANAGGAAGAGTGNNNNNNGGANGGNGNNAGNNANNGANGGANNNGGNNNNNGGNNNNGGGNGANGGGGGNGNGGNNGGGGGNG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCTGGTAGCGGGTGGA