ORFeome > bbs5 ORF1 – XORFeome v1.0

bbs5 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: bbs5
Gene ID: 965970
Gene Page ID: 965963
ORF Xenbase ID: 17266023

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081218
Original XGC clone length: 1098

Human orthology & disease relationships

NCBI Entrez ID: 129880
Ensembl gene IDs: ENSG00000163093
Directly associated (OMIM) disease MIM numbers: 615983
Indirectly associated (Lage, et al.) disease MIM numbers: 209900

Library Location

Plate ID: GDExl11005
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ839924
dbEST ID: 79657626
Trimmed Sequence: ATGCTGTCTGTGTTGGACGCGCTGTGGGAGGATCGGGATGTTCGCTTTGATATATCGCCCCAGCAAATGAAAATGAGACCAGGGGAAGTGCTCATAGACTGCTTAGATTCTATTGAGGATACCAAAGGAAACAATGGAGACAGAGGAAGACTGCTAGTCACCAATTTACGAGTTATTTGGCATTCCCTAGCACTTCCCCGTGTGAATCTTGCTGTTGGCTACAACTGTATTATAAACATCACGACAAGGACTGCTAATTCGAAATTACGTGGTCAGACTGAAGCACTGTACATCTTAACAAAATGCAACAATACTCGCTTTGAGTTTATCTTTACAAATCTTGTACCTGGGAGTCCTAGACTGTTTACTTCTGTTATCGCTGTACACAGAGCTTATGAGACATCTAAAATGTATCGTGATCTCAAACTGAGAGGCGCACTCATCCAAAATAAGCAGCTGAAGCTTCTTCCACGTGAACAAGTTTACGATAAAATCAATGGAGTGTGGAATTTATCCAGTGATCAGGGAAATTTGGGAACATTCTTTATAACCAATGTGAGAATAGTTTGGCATGCCAATATGAATGATAGTTTCAACGTCAGCAGTCCTTATCTGCAAATTCGTTCCATAAAAATCAGAGACTCAAAGTTTTGGTTTAGCACTTGTGAAAGAAAGCTCCCACCAAAATTGGTGGATACGTCCTTTGGCTTTAAAATTTGATCCCGTTTGAGAAACCTACAGGGATTTAATTGGAAGGAAAAAAAACCTTAATTGCCACAGGGGGCCTTCATTCCTGCCAAACCCCCCATTATTTTTGG
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGTCTGTGTTGGACGCGCTGTGGGAGGATCGGGATGTTCGCTTTGATATATCGCCCCAGCAAATGAAAATGAGACCAGGGGAAGTGCTCATAGACTGCTTAGATTCTATTGAGGATACCAAAGGAAACAATGGAGACAGAGGAAGACTGCTAGTCACCAATTTACGAGTTATTTGGCATTCCCTAGCACTTCCCCGTGTGAATCTTGCTGTTGGCTACAACTGTATTATAAACATCACGACAAGGACTGCTAATTCGAAATTACGTGGTCAGACTGAAGCACTGTACATCTTAACAAAATGCAACAATACTCGCTTTGAGTTTATCTTTACAAATCTTGTACCTGGGAGTCCTAGACTGTTTACTTCTGTTATCGCTGTACACAGAGCTTATGAGACATCTAAAATGTATCGTGATCTCAAACTGAGAGGCGCACTCATCCAAAATAAGCAGCTGAAGCTTCTTCCACGTGAACAAGTTTACGATAAAATCAATGGAGTGTGGAATTTATCCAGTGATCAGGGAAATTTGGGAACATTCTTTATAACCAATGTGAGAATAGTTTGGCATGCCAATATGAATGATAGTTTCAACGTCAGCAGTCCTTATCTGCAAATTCGTTCCATAAAAATCAGAGACTCAAAGTTTTGGTTTAGCACTTGTGAAAGAAAGCTCCCACCAAAATTGGTGGATACGTCCTTTGGCTTTAAAATTTGATCCCGTTTGAGAAACCTACAGGGATTTAATTGGAAGGAAAAAAAACCTTAATTGCCACAGGGGGCCTTCATTCCTGCCAAACCCCCCATTATTTTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGTCTGTGTTGGACGCGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839923
dbEST ID: 79657625
Trimmed Sequence: TTTTACTATTTTTGTCCCATTCTGTGATATGTATATGTAAAGAAAATCTGCAGCAATTGTTACACTGTTAAATCGTATGCTACCATGCAGCTTAGTCAAGCTGTGGTGAAACCATCCAGAATACATTCTTGTAAATATTAATATATAAATGATTTGCCTGGTAAAATATGAAATCCTAGAAAGACGACTTACCACAAATGCATCAGTGTGTTCATCAGCTTCTATTTCAACATCATCTTGAACCTGCTCTATGGTTAATTCTTCAAGGGCCTGTGGCTTTTCCTCCATCTCATACTCTACTCCAAATATGGGGCTTGCAGAGTAGACCCTGTGCAATGAGTTTATCTCCTTCACTGAATCCTGTAGCTTCTCAACTGGATCAATTTTAAAGCCAAGGACGTATCCACCACTCTGCTGGGAGCTTTCTATCACCAGTGCTAAACCAAACTTTGAGTCTCTGATTTTTATGGAACGAATTTGCAGATAAGGAATGCTGACGTTGAAACTATCATTCATATTGGCATGCCAAACTATTCTCACATTGGTTATAAAGAATGTTCCCAAATTTCCCTGATCACTGGATAAATTCACACTCCATTGATTTTATCGTAAACTTGTTCACGTGGAAGAAGCTTCAGCTGCTTANTTTTGGATGAGTGCGCCTCTCAGTTTGAGATCACGATACATTTTAGATGTCTCATAACCTCTGTGTACGGCGATTACAGAAGTAAACAGTCTAGGACTCCCCAGGTACAAAAATTTGTAAGAATAAAA
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTTACTATTTTTGTCCCATTCTGTGATATGTATATGTAAAGAAAATCTGCAGCAATTGTTACACTGTTAAATCGTATGCTACCATGCAGCTTAGTCAAGCTGTGGTGAAACCATCCAGAATACATTCTTGTAAATATTAATATATAAATGATTTGCCTGGTAAAATATGAAATCCTAGAAAGACGACTTACCACAAATGCATCAGTGTGTTCATCAGCTTCTATTTCAACATCATCTTGAACCTGCTCTATGGTTAATTCTTCAAGGGCCTGTGGCTTTTCCTCCATCTCATACTCTACTCCAAATATGGGGCTTGCAGAGTAGACCCTGTGCAATGAGTTTATCTCCTTCACTGAATCCTGTAGCTTCTCAACTGGATCAATTTTAAAGCCAAGGACGTATCCACCACTCTGCTGGGAGCTTTCTATCACCAGTGCTAAACCAAACTTTGAGTCTCTGATTTTTATGGAACGAATTTGCAGATAAGGAATGCTGACGTTGAAACTATCATTCATATTGGCATGCCAAACTATTCTCACATTGGTTATAAAGAATGTTCCCAAATTTCCCTGATCACTGGATAAATTCACACTCCATTGATTTTATCGTAAACTTGTTCACGTGGAAGAAGCTTCAGCTGCTTANTTTTGGATGAGTGCGCCTCTCAGTTTGAGATCACGATACATTTTAGATGTCTCATAACCTCTGTGTACGGCGATTACAGAAGTAAACAGTCTAGGACTCCCCAGGTACAAAAATTTGTAAGAATAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTACTATTTTTGTCCCATTCT