ORFeome > bcar1 ORF1 – XORFeome v1.0

bcar1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bcar1
Gene ID: 955193
Gene Page ID: 955188
ORF Xenbase ID: 17266047

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060334
Original XGC clone length: 2856

Human orthology & disease relationships

NCBI Entrez ID: 9564
Ensembl gene IDs: ENSG00000050820
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,114500,125853,130060,131760,131800,131900,131960,166200,166210,166220,179850,256100,256300,259420,266900,600995,601553,604370,607785,607832,608232,608354,608355,609040,609352,609583

Library Location

Plate ID: GDExl11021
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ824781
dbEST ID: 79642483
Trimmed Sequence: ATGAACTATCTGAATGTTTTGGCCAAAGCTCTTTATGATAATGTGGCTGAGTCACCAGACGAGCTGTCTTTTCGCAAGGGGGATATCATGACTGTACTTGAACGAAACACTCAGGGTCTTGATGGCTGGTGGCTTTGCTCTCTACATGGAAGACAGGGAATTGTCCCAGGAAACAGGCTGAAAATTCTGGTTGGAATGTATGACAAGAAGCAGGGTTCTGGTGACCAGTGCCAGCAGAAGTCTCAGCAACAACCACAGCAGCAGCCACCCCAAACTCCACTAACTTGTCAACACCAGGGAGTCTATAATGTGGTCACATCAACAAATCAGTATACACCAATGCAATCTGCTTACCAGAGTCCAGGTGGAGAAAATGTGTATTTGATGCCAGCACTTTCTAAGGGGCAGCAGGGGCTCTATCAGAACCCTCAGGGGCAACCGCATCCAGGTCAAACAACACCATCAAAACAAGCCACCTTGTACCAGAACCAGCCTGCTCAGCACCAGTTTCCAGGCCAAGAACAAGACATCTATCAAGTCCCACCATCTATGAACCAACCACAGGAGCTCTACCAAGTTCCAGTGGGATCCACAAGCCCTCCTCAGCTTCAGGATGTCTATCAAGTCCCACCTTCTTCTGGAACAGTACAAGACATATATCAGGTTCCATCTTTCATGACCTCTTCACAGGAAATATATCANGTACCACCATCCATGGATATGAGGGGGAGCGGAGGTCAGGAAGATGCCNTGGAAAGGGTGTACTTTCCTACACGCGTTGGGCCAGGGTTTATGGTTTAGTGATGCAGCGAAANTCAGGAGCAACAGGGGATTAAAAAT
Full Trace Sequence: AATAATGGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACTATCTGAATGTTTTGGCCAAAGCTCTTTATGATAATGTGGCTGAGTCACCAGACGAGCTGTCTTTTCGCAAGGGGGATATCATGACTGTACTTGAACGAAACACTCAGGGTCTTGATGGCTGGTGGCTTTGCTCTCTACATGGAAGACAGGGAATTGTCCCAGGAAACAGGCTGAAAATTCTGGTTGGAATGTATGACAAGAAGCAGGGTTCTGGTGACCAGTGCCAGCAGAAGTCTCAGCAACAACCACAGCAGCAGCCACCCCAAACTCCACTAACTTGTCAACACCAGGGAGTCTATAATGTGGTCACATCAACAAATCAGTATACACCAATGCAATCTGCTTACCAGAGTCCAGGTGGAGAAAATGTGTATTTGATGCCAGCACTTTCTAAGGGGCAGCAGGGGCTCTATCAGAACCCTCAGGGGCAACCGCATCCAGGTCAAACAACACCATCAAAACAAGCCACCTTGTACCAGAACCAGCCTGCTCAGCACCAGTTTCCAGGCCAAGAACAAGACATCTATCAAGTCCCACCATCTATGAACCAACCACAGGAGCTCTACCAAGTTCCAGTGGGATCCACAAGCCCTCCTCAGCTTCAGGATGTCTATCAAGTCCCACCTTCTTCTGGAACAGTACAAGACATATATCAGGTTCCATCTTTCATGACCTCTTCACAGGAAATATATCANGTACCACCATCCATGGATATGAGGGGGAGCGGAGGTCAGGAAGATGCCNTGGAAAGGGTGTACTTTCCTACACGCGTTGGGCCAGGGTTTATGGTTTAGTGATGCAGCGAAANTCAGGAGCAACAGGGGATTAAAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACTATCTGAATGTTTTGGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ830149
dbEST ID: 79647851
Trimmed Sequence: CATCGCAGCTAGCTGACCAAGAACCATTCGAAACTGTTGGGTACTGCTATTTAGGTCTTTGACTCTATCAACCATATCCTTGGCTGCTGCGGGAGATGGGTATTGAAGTGCAGCTGTCTTGGTGGTGAGAACGATCTCCTTGAGCTTGTCACATAGTATGTTACTGTGGTGAGTGACTTTGTTTCGTATGTCCTGAGCTTTGGCTTGGCGTGACAAGGTGTCTCCAATAAAGACCAGCTTGTGTGCACTAAGGATGACAAACTTGCTGTGAGCCACAAAAATTTTGGGAGGCTGGTTGCTACTGATGGAACTGTAAAAGGCATCGATGGCATTGGTGAGGGTGGTCACATTGGCTTCACATTGCTCTTGATAGAAAAGAAGCAACTGTCGATCTGAATTGCCAAGTGCACTCCGAACCTGGCTGTAGTGCTGAGGAGGCGTCCAGTTTGAAAGGTCACTCTCAATGGGTCGTGCGACCTCCTCCTGTAGACGTTCAAACTGTTTTAGCTGTTGCTGCTCTAGATGACCTTTTCCTTGCTTTATTATATTTCCCTTTTCTAGTAATTCCTTCTGTGTCTTTTCAAATTCCTCCTTTTCCTGCAAATGTACATAGTCATAATCTTCCATCCNACCGCTCTCATTATTCTCATACTGTCCTTCANGAGACTCCTCGGCTATAAACTTAGGAAGGGGATGGCAGGGGGTCTTGGACTGTATGCTTATTTTTTTCCTGTTGGGTTCCTGTTTTGTCCCACCTGTACCAA
Full Trace Sequence: GGCCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATCGCAGCTAGCTGACCAAGAACCATTCGAAACTGTTGGGTACTGCTATTTAGGTCTTTGACTCTATCAACCATATCCTTGGCTGCTGCGGGAGATGGGTATTGAAGTGCAGCTGTCTTGGTGGTGAGAACGATCTCCTTGAGCTTGTCACATAGTATGTTACTGTGGTGAGTGACTTTGTTTCGTATGTCCTGAGCTTTGGCTTGGCGTGACAAGGTGTCTCCAATAAAGACCAGCTTGTGTGCACTAAGGATGACAAACTTGCTGTGAGCCACAAAAATTTTGGGAGGCTGGTTGCTACTGATGGAACTGTAAAAGGCATCGATGGCATTGGTGAGGGTGGTCACATTGGCTTCACATTGCTCTTGATAGAAAAGAAGCAACTGTCGATCTGAATTGCCAAGTGCACTCCGAACCTGGCTGTAGTGCTGAGGAGGCGTCCAGTTTGAAAGGTCACTCTCAATGGGTCGTGCGACCTCCTCCTGTAGACGTTCAAACTGTTTTAGCTGTTGCTGCTCTAGATGACCTTTTCCTTGCTTTATTATATTTCCCTTTTCTAGTAATTCCTTCTGTGTCTTTTCAAATTCCTCCTTTTCCTGCAAATGTACATAGTCATAATCTTCCATCCNACCGCTCTCATTATTCTCATACTGTCCTTCANGAGACTCCTCGGCTATAAACTTAGGAAGGGGATGGCAGGGGGTCTTGGACTGTATGCTTATTTTTTTCCTGTTGGGTTCCTGTTTTGTCCCACCTGTACCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATCGCAGCTAGCTGACCAA