ORFeome > bcl11a ORF1 – XORFeome v1.0

bcl11a ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bcl11a
Gene ID: 865631
Gene Page ID: 486640
ORF Xenbase ID: 17266089

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060405
Original XGC clone length: 2184

Human orthology & disease relationships

NCBI Entrez ID: 53335
Ensembl gene IDs: ENSG00000119866
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112500,126600,142945,145260,147250,168500,214150,216400,278780,601675,604757,605462,607080,607778,608320

Library Location

Plate ID: GDExl11021
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AGAGCATAATTGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCCACTTTGTACAAAAAAGTTGGCACCATGGTACACAAGAAAACTACTGAAATGAAAGGATTTCACCGTTCTTTTAAGGGTCAGAACCCTTTTGACGCAGCTTATGAGATGGAAGCCAGAAACATGGAATCAGTGTTCAATTTTGACTGCCCCTCTCGTCCTGATGTGCCTTCCAGTGCCCCCATTGATATCCCTGATGCCAAAAAAAGAACAAAGAAGAAAAAACGTTGCAGGGCAACAGACAGCTTTACTGGGCGGTTTGATGATATGTACCAGTTGCAGCAAGAAATCCTTGGAGAAGGTGCTTATGCAAAAGTTCATAGCTGCATTAATCTCATCACCAATAAGGAGTATGCTGTAAAGATAATTGAGAAAAGGCCTGGCCACAGTAGAAGCAGAGTTTTCAGGGAGGTGGAGATGTTGTATCAATGTCAGGGTCATAGCAACGTATTGGAACTAATAGAATTCTTTGAAGAGGAAGATAAATTCTACCTGGTGTTTGAGAAGATGTGTGGTGGTTCCATACTGAATCACATTCACCTACGCATGCATTTCAATGAACGAGAGGCTACTTTTGTGGTGCGGGACATTGCAGAAGCTCTAAACTATTTGCACCACAAAGGTATAGCACATAGGGACCTGAAACCTGAACATATACTTTTGTGAAAGCCCTCATCAAGTGTCACCAGTGAAGATTTGTGATTTCCAACTTTGGAAGGGGTATTAAACCTGAAAAGTGACTTGCTCCCCAATTCTCCACGCCCCAACTGCTCCAACCTTGTGGGACCTCCCAAAACAAGGGGCCCCCGGAAAGTGGGTTGAAACCTTAAAAGAGAAAAAACCCCATTATTAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCGCCGCAAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ830179
dbEST ID: 79647881
Trimmed Sequence: GACTTCTTGCCATATATATTTGATTGTTCTGTCCTTAGATTTAATGATGCTGTATTTTCCCCAAGTATCACTGCGCCTGCTCTCTTTTGAACTGGGCCTTCCAGGCCCTGGCCCGCTAATATGAGGAGTGCTTCCACCACTTCCTGTACCACTGCGGCCGGATATTCCTCCATCCATTTCTCCTGGAGGTGTGGAGAAGCGTAAACTGCCATTTTCAGATGAATGTTCTGAGGAGGAGGCAAAAGGCGATTGTCTGGAGTCTCCAAAAGTTAGGAATGGATCTTTTAGCTGCCTTGAAGCGGCATAGCCAGCAAGCCATTGGGAGTAAACATTTTCTGTGTTAGGCATAGCTGACGCAGGTAGATCAAATTCCTTCTCGAGTTTAATGCGTTTAGAAAAAGGACTCAAAGAGCTTGGGCTTCCAAGAAGTAATTTTTTGGATAAGCCTCCTGAAGCAGATTCACCTGGGGAACACCCCCTCCCATTGACTGTGCCACTTTCAATGCGATCAGATTCTCCTGCCACTGAATCTTCATCGCAAGTGTCCCTTTGCACTTCTGGTTCAGATAAATGCCCTCTTTTATGCTTTTCCCACAATACTTGATGAAANGCATCACTAAAGTGATGCATTCAACAAAGACCCATGCTTTGCATGACTTCAGGCATAGATCTCTCCTCGACCGGATCTGGAAAGNATTTTTCATGGATGACGAACCTGCCTTTCCAGGGTAAAGGCCCAAAAACTATAAATCAAGGGCCCAACCGGTCCG
Full Trace Sequence: CTGGCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTTCTTGCCATATATATTTGATTGTTCTGTCCTTAGATTTAATGATGCTGTATTTTCCCCAAGTATCACTGCGCCTGCTCTCTTTTGAACTGGGCCTTCCAGGCCCTGGCCCGCTAATATGAGGAGTGCTTCCACCACTTCCTGTACCACTGCGGCCGGATATTCCTCCATCCATTTCTCCTGGAGGTGTGGAGAAGCGTAAACTGCCATTTTCAGATGAATGTTCTGAGGAGGAGGCAAAAGGCGATTGTCTGGAGTCTCCAAAAGTTAGGAATGGATCTTTTAGCTGCCTTGAAGCGGCATAGCCAGCAAGCCATTGGGAGTAAACATTTTCTGTGTTAGGCATAGCTGACGCAGGTAGATCAAATTCCTTCTCGAGTTTAATGCGTTTAGAAAAAGGACTCAAAGAGCTTGGGCTTCCAAGAAGTAATTTTTTGGATAAGCCTCCTGAAGCAGATTCACCTGGGGAACACCCCCTCCCATTGACTGTGCCACTTTCAATGCGATCAGATTCTCCTGCCACTGAATCTTCATCGCAAGTGTCCCTTTGCACTTCTGGTTCAGATAAATGCCCTCTTTTATGCTTTTCCCACAATACTTGATGAAANGCATCACTAAAGTGATGCATTCAACAAAGACCCATGCTTTGCATGACTTCAGGCATAGATCTCTCCTCGACCGGATCTGGAAAGNATTTTTCATGGATGACGAACCTGCCTTTCCAGGGTAAAGGCCCAAAAACTATAAATCAAGGGCCCAACCGGTCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTCTTGCCATATATATTT