ORFeome > bcl7c ORF1 – XORFeome v1.0

bcl7c ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bcl7c
Gene ID: 6252787
Gene Page ID: 6257728
ORF Xenbase ID: 17266125

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123218
Original XGC clone length: 630

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: F07

Sequences - 5ʹ (forward) EST

Accession: JZ838300
dbEST ID: 79656002
Trimmed Sequence: ATGGCTAACAGGACAGGCCGAGCAGAGACCAGGAGCCGGGCAAGAGATGACATCAAGAGAGTCATGGCAGTCATAGAGCACGTGAGACGGTGGGAGAAGCGTTGGGTGACAGTGGGAGACACCTCACTCCGGATATTTAAGTGGGTGCCTATTGTGGATCCCAGAGACGAGGAGAAGTCAGGGGCGCAGACTCCCACAGAGCAACAGAAGGCAAGAGAGAAGCGCAGAGCACAGCAGCGCAGGAAGAGCCATGCTCTGCTAATGATGGAGATCAATGATGACAGCAATAACAGTTCCCTGTCTGATGCCTCTGGAGCGAGGGGCGAGGGGAGCGACAGCCCAAGTCAGACCCCAGAACTCAGCCGGAATGTCAGCCCCTGCCCCTCAACCAGACCAAAGACTGAAGATTTCCAGCCCCCAGAATTGGGCCATGAAGGGGATGGAGCCCTCCTGCCCCCCATCAGAGCAGATGAACCCCCAATGTTAACTAAAGAGGAGCCAGTGGCTGAAACACCTGGAGCCCAGGTGCCCAGCGGTGCCGCCATCTGCCCACGTCTGTCTGAGGAGGAGAGTTTGGATGCGCCGGCGCTAAACAGATTCTGTACAGACCAAGTCATGATGGGGAAGATT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTAACAGGACAGGCCGAGCAGAGACCAGGAGCCGGGCAAGAGATGACATCAAGAGAGTCATGGCAGTCATAGAGCACGTGAGACGGTGGGAGAAGCGTTGGGTGACAGTGGGAGACACCTCACTCCGGATATTTAAGTGGGTGCCTATTGTGGATCCCAGAGACGAGGAGAAGTCAGGGGCGCAGACTCCCACAGAGCAACAGAAGGCAAGAGAGAAGCGCAGAGCACAGCAGCGCAGGAAGAGCCATGCTCTGCTAATGATGGAGATCAATGATGACAGCAATAACAGTTCCCTGTCTGATGCCTCTGGAGCGAGGGGCGAGGGGAGCGACAGCCCAAGTCAGACCCCAGAACTCAGCCGGAATGTCAGCCCCTGCCCCTCAACCAGACCAAAGACTGAAGATTTCCAGCCCCCAGAATTGGGCCATGAAGGGGATGGAGCCCTCCTGCCCCCCATCAGAGCAGATGAACCCCCAATGTTAACTAAAGAGGAGCCAGTGGCTGAAACACCTGGAGCCCAGGTGCCCAGCGGTGCCGCCATCTGCCCACGTCTGTCTGAGGAGGAGAGTTTGGATGCGCCGGCGCTAAACAGATTCTGTACAGACCAAGTCATGATGGGGAAGATTGCCAACTTTCTTGTTCAAAGTTGGCCTTATAAGAAAGCATTGCTTATCAATTTTGTTGCAACGAAAAGGGTCAAAATCAGTCAAAAAAAAAATCATTATTTTGCCATCCCACCTGAATTCCCCCTAAACTGGAATCCCTATTTAAAAAAAAAAAAAAAAGAAATAAAAAGAAAAACATCTAGAGCCCCCTGCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTAACAGGACAGGCCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838299
dbEST ID: 79656001
Trimmed Sequence: TCTTCCCATCATGACTTGGTCTGTACAGAATCTCTTTAGCGCCGGCGCATCCAAACTCTCCTCCTCAGACAGACGTGGGCAGATGGCGGCACCGCTGGGCACCTGGGCTCCAGGTGTTTCAGCCACTGGCTCCTCTTTAGTTAACATTGGGGGTTCATCTGCTCTGATGGGGGGCAGGAGGGCTCCATCCCCTTCATGGCCCAATTCTGGGGGCTGGAAATCTTCAGTCTTTGGTCTGGTTGAGGGGCAGGGGCTGACATTCCGGCTGAGTTCTGGGGTCTGACTTGGGCTGTCGCTCCCCTCGCCCCTCGCTCCAGAGGCATCAGACAGGGAACTGTTATTGCTGTCATCATTGATCTCCATCATTAGCAGAGCATGGCTCTTCCTGCGCTGCTGTGCTCTGCGCTTCTCTCTTGCCTTCTGTTGCTCTGTGGGAGTCTGCGCCCCTGACTTCTCCTCGTCTCTGGGATCCCACATAGGCAGCCACTTAAATATCCGGAGTGAGGTGTCTCCACTTGTCACCAACGCTTCTCCCAGCCGTCTCAGTGCTTCTATGATGCCATGAGTCTCTTGATGTCATCGTCTGCCCCGGCTCCGGGGTGTCTGCCCGGCCTTGTCTGGTTGCCAATGGGTGCCACTTTTTTTGTAATAATTTTGGGATTTATAAAAGAACATTGCCTAATCAATTTGGTTGCAACAAACGAGGTCCCTTTTCNAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAACCCAAACGCCTCGGCACAGGGCCG
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTTCCCATCATGACTTGGTCTGTACAGAATCTCTTTAGCGCCGGCGCATCCAAACTCTCCTCCTCAGACAGACGTGGGCAGATGGCGGCACCGCTGGGCACCTGGGCTCCAGGTGTTTCAGCCACTGGCTCCTCTTTAGTTAACATTGGGGGTTCATCTGCTCTGATGGGGGGCAGGAGGGCTCCATCCCCTTCATGGCCCAATTCTGGGGGCTGGAAATCTTCAGTCTTTGGTCTGGTTGAGGGGCAGGGGCTGACATTCCGGCTGAGTTCTGGGGTCTGACTTGGGCTGTCGCTCCCCTCGCCCCTCGCTCCAGAGGCATCAGACAGGGAACTGTTATTGCTGTCATCATTGATCTCCATCATTAGCAGAGCATGGCTCTTCCTGCGCTGCTGTGCTCTGCGCTTCTCTCTTGCCTTCTGTTGCTCTGTGGGAGTCTGCGCCCCTGACTTCTCCTCGTCTCTGGGATCCCACATAGGCAGCCACTTAAATATCCGGAGTGAGGTGTCTCCACTTGTCACCAACGCTTCTCCCAGCCGTCTCAGTGCTTCTATGATGCCATGAGTCTCTTGATGTCATCGTCTGCCCCGGCTCCGGGGTGTCTGCCCGGCCTTGTCTGGTTGCCAATGGGTGCCACTTTTTTTGTAATAATTTTGGGATTTATAAAAGAACATTGCCTAATCAATTTGGTTGCAACAAACGAGGTCCCTTTTCNAAAAAAAAAAAAAAAAAGAAAAAAAAAAAAACCCAAACGCCTCGGCACAGGGCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTCCCATCATGACTTGGTCT