ORFeome > bin1 ORF1 – XORFeome v1.0

bin1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bin1
Gene ID: 6253610
Gene Page ID: 979734
ORF Xenbase ID: 17266233

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046852
Original XGC clone length: 1437

Human orthology & disease relationships

NCBI Entrez ID: 274
Ensembl gene IDs: ENSG00000136717
Directly associated (OMIM) disease MIM numbers: 255200
Indirectly associated (Lage, et al.) disease MIM numbers: 125853,130060,151623,166200,166210,166220,233700,233710,259420,275355,306400,607785,608232,608354,608355

Library Location

Plate ID: GDExl11013
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ824064
dbEST ID: 79641766
Trimmed Sequence: ATGGCTGAGCTCGGGAAGGGAGTCTCTGCGGGCAAATTAGCCAGCAACATGCAGAAGAAACTCACCCGGGCCCAGGAGAAGGTCCTCCAGAAATTGGGAAAAGCAGATGAAACAAAGGATGAGCAGTTTGAGTCGTGTGTGCAGAACTTCAACAAACAGCTGACAGAAGGTTCCAAACTTCAAAAGGATCTCCGAGCTTATTTGGCAACAGTAAAAGCGATGCACGAAGCTTCCAAGAAACTGACCGAATGTTTGCTGGATGTCTATGAGCCGGACTGGCCAGGGAGGGAGGAGACGAACAAAATTGCCGAGAACAATGACCTGCTCTGGACCGACTATCATCAGAAGCTGGTGGATCAGGCCCTGCTCACAATGGACACCTACCTCGGGCAGTTCCCTGATATTAAGTCACGCATCGCCAAGCGCGGGAGGAAACTGGTGGATTTCGACAGCGCCCGGCATCACTTTGAATCCCTACAGAATGCGAAAAAGAAGGACGAAACTAAAATCGCCAAGGCCGAGGAGGATCTGCTAAAATCCCAGAAAGTGTTTGAAGAGATGAATGTTGATTTACAGGAGGAGCTGCCTTCTCTGTGGAATAGCCGTGTTGGTTTCTATGTCAACACATTCCAGAGTATTGCTTGGGCTGGAAGAAAACTTCCATAANGAGATGGGGCAAGCTGCACCAGAATCTCAATGAAGATGATGGTGAATTTTGGAATCGAGGCAGGGGAAACTCTCCACCAAACTCCTTTTCCGGTTAAA
Full Trace Sequence: AATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGCTCGGGAAGGGAGTCTCTGCGGGCAAATTAGCCAGCAACATGCAGAAGAAACTCACCCGGGCCCAGGAGAAGGTCCTCCAGAAATTGGGAAAAGCAGATGAAACAAAGGATGAGCAGTTTGAGTCGTGTGTGCAGAACTTCAACAAACAGCTGACAGAAGGTTCCAAACTTCAAAAGGATCTCCGAGCTTATTTGGCAACAGTAAAAGCGATGCACGAAGCTTCCAAGAAACTGACCGAATGTTTGCTGGATGTCTATGAGCCGGACTGGCCAGGGAGGGAGGAGACGAACAAAATTGCCGAGAACAATGACCTGCTCTGGACCGACTATCATCAGAAGCTGGTGGATCAGGCCCTGCTCACAATGGACACCTACCTCGGGCAGTTCCCTGATATTAAGTCACGCATCGCCAAGCGCGGGAGGAAACTGGTGGATTTCGACAGCGCCCGGCATCACTTTGAATCCCTACAGAATGCGAAAAAGAAGGACGAAACTAAAATCGCCAAGGCCGAGGAGGATCTGCTAAAATCCCAGAAAGTGTTTGAAGAGATGAATGTTGATTTACAGGAGGAGCTGCCTTCTCTGTGGAATAGCCGTGTTGGTTTCTATGTCAACACATTCCAGAGTATTGCTTGGGCTGGAAGAAAACTTCCATAANGAGATGGGGCAAGCTGCACCAGAATCTCAATGAAGATGATGGTGAATTTTGGAATCGAGGCAGGGGAAACTCTCCACCAAACTCCTTTTCCGGTTAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGCTCGGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829374
dbEST ID: 79647076
Trimmed Sequence: CAGGTTCTTCTCTGTAAAGTTCTCTGGGAAGACCCCTCGGTGCTGTTCAAATGGTTTGCTCTGCAGCCAGTCTGTCTCCTTAATTCCCATGAGCCAGCCATCATCCTGCTCATCAGGATTTTCAAACTGAGTCACCAGCACCACTTCGCCGGCTTTCAATTCTAATTCGTCGCCGTCGGTTGCAGTGTAATCATGTTGGGCTCTGACCTTATACAAGAAGCCAGGGGGCATCTCTGGTTTTGGGGGACTGGACTCCACAGTACCATTGACTGCAGCAGAAAAGGTTTCCACCACCACAGCAGGAAGAGAGCTCGGGGATTTATCAGGCACCTCTTCAGGTGGAGCAGATTCAAATTTGACTTCAGTTTCCTTCTTGGCTGGTTCGTTTACAGACACAGGAGCTGGAGCTGGTTCCACTGGCTGTGAAGGTGACTTGGATATGGCCACAGATGGCGTCTCCTCAACAGCCACAGAAGGAGCTTCAAAATCATGGTTGACAGTCTTTGTTTCAGAGACAGCTGGTGGTCCATCAGAAGCAGGTGGAGATGGGTTCGTGTTCGTCTTCGTGGGGGTTGATTCACTGTGAATACAATGACTGCCCTTCTTTATCCTCAGACGGGAAGAACAAGTTTCATTTTCTTTCTGTTTGGAGTTGGGTATGTTTTCAAACTTTGGCTTGAACTTTTAAACACTGGAAAGA
Full Trace Sequence: CTGGCAGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGGTTCTTCTCTGTAAAGTTCTCTGGGAAGACCCCTCGGTGCTGTTCAAATGGTTTGCTCTGCAGCCAGTCTGTCTCCTTAATTCCCATGAGCCAGCCATCATCCTGCTCATCAGGATTTTCAAACTGAGTCACCAGCACCACTTCGCCGGCTTTCAATTCTAATTCGTCGCCGTCGGTTGCAGTGTAATCATGTTGGGCTCTGACCTTATACAAGAAGCCAGGGGGCATCTCTGGTTTTGGGGGACTGGACTCCACAGTACCATTGACTGCAGCAGAAAAGGTTTCCACCACCACAGCAGGAAGAGAGCTCGGGGATTTATCAGGCACCTCTTCAGGTGGAGCAGATTCAAATTTGACTTCAGTTTCCTTCTTGGCTGGTTCGTTTACAGACACAGGAGCTGGAGCTGGTTCCACTGGCTGTGAAGGTGACTTGGATATGGCCACAGATGGCGTCTCCTCAACAGCCACAGAAGGAGCTTCAAAATCATGGTTGACAGTCTTTGTTTCAGAGACAGCTGGTGGTCCATCAGAAGCAGGTGGAGATGGGTTCGTGTTCGTCTTCGTGGGGGTTGATTCACTGTGAATACAATGACTGCCCTTCTTTATCCTCAGACGGGAAGAACAAGTTTCATTTTCTTTCTGTTTGGAGTTGGGTATGTTTTCAAACTTTGGCTTGAACTTTTAAACACTGGAAAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTTCTTCTCTGTAAAGTTC