ORFeome > bmf ORF1 – XORFeome v1.0

bmf ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bmf
Gene ID: 6255230
Gene Page ID: 982388
ORF Xenbase ID: 17266329

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC133770
Original XGC clone length: 354

Human orthology & disease relationships

NCBI Entrez ID: 90427
Ensembl gene IDs: ENSG00000104081
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 101900,124200,228600,236490,300291,300301,300584,308300,600072,603218

Library Location

Plate ID: GDExl11089
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ838483
dbEST ID: 79656185
Trimmed Sequence: ATGGATGAGTTAGATGATGATGTGTTTTATCCTGATGCATTTGGATACCCAGATCAGACCATAACTTCCTCCTCATTATTCAACCAGAGCCAGTCCTACACATGCCTGCTCGGCCGCTTTCACCTCTTCCCATTTTCTCACTGTTGTGGCCCTGGATGCAGGGGCACAGACAACGAGGACAAGGCTACACAGACTCTGGGGTCACCTTCTCAGGACATCATGCTACCATGTGGGGTGTCTGAAACTCCTCAAAGACTTTTTTATGGTAAGGAGGCCTTATCAGAGATATACCGTATGTTTAATGCTTCAATCCCACATGAATCTCATAGATTCCATAGACTTTTTCAAGTATT
Full Trace Sequence: TCGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGAGTTAGATGATGATGTGTTTTATCCTGATGCATTTGGATACCCAGATCAGACCATAACTTCCTCCTCATTATTCAACCAGAGCCAGTCCTACACATGCCTGCTCGGCCGCTTTCACCTCTTCCCATTTTCTCACTGTTGTGGCCCTGGATGCAGGGGCACAGACAACGAGGACAAGGCTACACAGACTCTGGGGTCACCTTCTCAGGACATCATGCTACCATGTGGGGTGTCTGAAACTCCTCAAAGACTTTTTTATGGTAAGGAGGCCTTATCAGAGATATACCGTATGTTTAATGCTTCAATCCCACATGAATCTCATAGATTCCATAGACTTTTTCAAGTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCNGCACAAGAAAAAATAACAAAATCTAAAACCGTGACACCGGCACACCGGCGCGGACAAAAGGCAAAAGCCTCCCCGGAAAAAAAGAACTCCGGGTTTATCATTTTTTTTTGAGGGAAAAACACCACCAAAACACAAAAAAAAAAAACCGGGGCGGGGTTATTAACTTTTTTAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGAGTTAGATGATGATGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838482
dbEST ID: 79656184
Trimmed Sequence: TACTTGAAAAAGTCTATGGAATCTATGAGATTCATGTGGGATTGAAGCATTAAACATACGGTATATCTCTGATAAGGCCTCCTTACCATAAAAAAGTCTTTGAGGAGTTTCAGACACCCCACATGGTAGCATGATGTCCTGAGAAGGTGACCCCAGAGTCTGTGTAGCCTTGTCCTCGTTGTCTGTGCCCCTGCATCCNGGGCCACAACAGTGAGAAAATGGGAAGAGGTGAAAGCGGCCGAGCAGGCATGTGTAGGACTGGCTCTGGTTGAATAATGAGGAGGAAGTTATGGTCTGATCTGGGTATCCAAATGCATCAGGATAAAACACATCATCATCTAACTCATCCATGG
Full Trace Sequence: CGGGGAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATACTTGAAAAAGTCTATGGAATCTATGAGATTCATGTGGGATTGAAGCATTAAACATACGGTATATCTCTGATAAGGCCTCCTTACCATAAAAAAGTCTTTGAGGAGTTTCAGACACCCCACATGGTAGCATGATGTCCTGAGAAGGTGACCCCAGAGTCTGTGTAGCCTTGTCCTCGTTGTCTGTGCCCCTGCATCCNGGGCCACAACAGTGAGAAAATGGGAAGAGGTGAAAGCGGCCGAGCAGGCATGTGTAGGACTGGCTCTGGTTGAATAATGAGGAGGAAGTTATGGTCTGATCTGGGTATCCAAATGCATCAGGATAAAACACATCATCATCTAACTCATCCATGGTGCCAACTTTTTTGTACAAAGTTGGGCATTATAAAAAAGCATTGCTCAGCAATTTGTTGCAACGAACAGGTCACTATCAGTCCAAAATAGATCATTATTTTGGTGCCCGACCTTTNAAGAAAAAAAAAAATAAAAAGAATAACCAAAGGCTCGCGCCGGGCGCGCGCCAAAAAAAAGAAAGGCTTCTTCGGGAAAAAAGGGGATTTGGGGTTTAATTTTTGTGTGGAAAGGGAAGAACAGACGAAACCGGGGGAGAATAACCCTGGATAGGGTTTATAGGTGTTTTGAGAAGGAAAGAGGTGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTTGAAAAAGTCTATGGAA