ORFeome > bmp7.1 ORF2 – XORFeome v1.0

bmp7.1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bmp7.1
Gene ID: 486018
Gene Page ID: 486013
ORF Xenbase ID: 17266383

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108477
Original XGC clone length: 1275

Human orthology & disease relationships

NCBI Entrez ID: 655
Ensembl gene IDs: ENSG00000101144
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,113100,158350,174900,184460,185800,186500,186570,200700,201250,228900,261550,609441,610017,610069

Library Location

Plate ID: GDExl11087
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ837957
dbEST ID: 79655659
Trimmed Sequence: ATGAATGTTCTGCAAAAGAACAAAACAGGTTCTGTTCTCCTTTGGACATACTTCTTGTGGAGGATCATCCTGGCTGACTTCACCTTGGACAATGAGGTGCACTCTAGCTTTATCCAAAGGAGGTTGCGAGGCCAGGAGCGCAGGGAGATGCAGAGAGAGATTTTGTCCATCCTGGGGCTGCCGCACAGACCCAGACCCCATTTGTATGGAAAGCAAAATTCTGCCCCTATGTTTATGCTGGATTTGTACAATGCTATGACAGTGGAAGAAGAGGAAGCTGAAGGCTTCTCTTATCCATACAAGCCCATCTTTACCACCCAGGGGCCACCGCTGGCCACCCAACAGGACAGCAACTTCCTCAATGACGCTGACATGGTTATGAGTTTCGTTAATCTAGTGGAGCACGATAAAGAATTCTTCCATCAGAGGCGGCACCAGCGGGAATTCCGGTTTGACCTCGCCAAAATCCCAGAAGGAGAAGCAGTGACAGCAGCTGAGTTCAGGATATATAAGGATTATATCCGGGAAAGGTTTGAAAATGAGACGTTCCAGATCAGTGTCTACCAAGTCCTGCAGGAACACCAAGGCAGAGATTCTGACCTGTACAAACTGGACTCTAAAACAATCTGGGCTGCAGAAAAAAGATGGCTGGTGTTTGATATCACAACAACCAGTAATCCACTTGGTAGGGAAACCCCCAACCAATCTTGGATTGCAGCTGTCCTGTGAAAAATTTTCAAATGAAAAAAACAATTAAACCCCCAAAAGGGCC
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATGTTCTGCAAAAGAACAAAACAGGTTCTGTTCTCCTTTGGACATACTTCTTGTGGAGGATCATCCTGGCTGACTTCACCTTGGACAATGAGGTGCACTCTAGCTTTATCCAAAGGAGGTTGCGAGGCCAGGAGCGCAGGGAGATGCAGAGAGAGATTTTGTCCATCCTGGGGCTGCCGCACAGACCCAGACCCCATTTGTATGGAAAGCAAAATTCTGCCCCTATGTTTATGCTGGATTTGTACAATGCTATGACAGTGGAAGAAGAGGAAGCTGAAGGCTTCTCTTATCCATACAAGCCCATCTTTACCACCCAGGGGCCACCGCTGGCCACCCAACAGGACAGCAACTTCCTCAATGACGCTGACATGGTTATGAGTTTCGTTAATCTAGTGGAGCACGATAAAGAATTCTTCCATCAGAGGCGGCACCAGCGGGAATTCCGGTTTGACCTCGCCAAAATCCCAGAAGGAGAAGCAGTGACAGCAGCTGAGTTCAGGATATATAAGGATTATATCCGGGAAAGGTTTGAAAATGAGACGTTCCAGATCAGTGTCTACCAAGTCCTGCAGGAACACCAAGGCAGAGATTCTGACCTGTACAAACTGGACTCTAAAACAATCTGGGCTGCAGAAAAAAGATGGCTGGTGTTTGATATCACAACAACCAGTAATCCACTTGGTAGGGAAACCCCCAACCAATCTTGGATTGCAGCTGTCCTGTGAAAAATTTTCAAATGAAAAAAACAATTAAACCCCCAAAAGGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGTTCTGCAAAAGAACAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837956
dbEST ID: 79655658
Trimmed Sequence: GTGGCATCCACAGGCTCTGACCACCATGTTTCTGTATTTCTTAAGGATTACGTTGGAACTGTCATCAAAATAAAGAACGGAGATGGCGTTGAGCTGAGTAGGGGCACAGCATGGCTTTGGAACAGTGTCTGGGTTGATGAAATGAACCAGAGTCTGTACAATAGCATGGTTTGTTGCATTCATGTATGAATTAAGAGGGAATGCACACTCTCCTTCACAGTAAAATGCTGCATATCCCTCAGGGGCGATAATCCAGTCCTGCCAGCCAAGGTCTTTGAAGCTAACGTACAACTCGTGTTTCTTGCAAGCTTGTTTCTGATCAGTGCTACTGTTTTCTGCAATATTGGACACCCGTAGTGCCTCTTGGCTCTTTGGTGCTTTGGATCTATTTTGGTTTCGTTGTTTCCCGCCAGCAGATCGAATGCTGCGCAGGTGGATTTCAGTGGCTTTAAAGAATGCCACCATGAAGGGCTGTTTATTGTGCGGTCCGTTGGTTCCTATCAAGCCAGCCATTTTGGGATTAATGCTCTGTCCATCGAAACTCTCCACAGACAGCTGCAATCCAAGATTTGTGTTGCGGGGTTCGCTACCCCATGATTAACTGGTCGTTGTGATATCAAACACCAGCCATCCCTTCTTCTGCAGCCCCGAATTGGTCCTAAAGTCCCAGTTTCTTAACAGGTCAGAATCCTCTTCCCTTGGGTGTC
Full Trace Sequence: GAAACAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGCATCCACAGGCTCTGACCACCATGTTTCTGTATTTCTTAAGGATTACGTTGGAACTGTCATCAAAATAAAGAACGGAGATGGCGTTGAGCTGAGTAGGGGCACAGCATGGCTTTGGAACAGTGTCTGGGTTGATGAAATGAACCAGAGTCTGTACAATAGCATGGTTTGTTGCATTCATGTATGAATTAAGAGGGAATGCACACTCTCCTTCACAGTAAAATGCTGCATATCCCTCAGGGGCGATAATCCAGTCCTGCCAGCCAAGGTCTTTGAAGCTAACGTACAACTCGTGTTTCTTGCAAGCTTGTTTCTGATCAGTGCTACTGTTTTCTGCAATATTGGACACCCGTAGTGCCTCTTGGCTCTTTGGTGCTTTGGATCTATTTTGGTTTCGTTGTTTCCCGCCAGCAGATCGAATGCTGCGCAGGTGGATTTCAGTGGCTTTAAAGAATGCCACCATGAAGGGCTGTTTATTGTGCGGTCCGTTGGTTCCTATCAAGCCAGCCATTTTGGGATTAATGCTCTGTCCATCGAAACTCTCCACAGACAGCTGCAATCCAAGATTTGTGTTGCGGGGTTCGCTACCCCATGATTAACTGGTCGTTGTGATATCAAACACCAGCCATCCCTTCTTCTGCAGCCCCGAATTGGTCCTAAAGTCCCAGTTTCTTAACAGGTCAGAATCCTCTTCCCTTGGGTGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGCATCCACAGGCTC