ORFeome > bnip1 ORF1 – XORFeome v1.0

bnip1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: bnip1
Gene ID: 977999
Gene Page ID: 977995
ORF Xenbase ID: 17266395

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054986
Original XGC clone length: 684

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ839254
dbEST ID: 79656956
Trimmed Sequence: ATGGCAGATTCCCAGGATGTCCACGTCCGGATCTGTCATCAGGAAATCGTGAGATATGATCTGGAGATCAAAGCGCTGATCCAGGATATCAGAGAATGTCCTGGTCCTCTAAGCACCCTGAATGATCTCAATGCTCAAGTCAAGGAGAAATTACACCTGCTGAGGTTGAGAATACAGGATTTTGAACAATTGGCCAAGGAGCAGGATAAGGAATCTGACAAGCAAGCATTGCTGAAGGAGATGGAGTGTCACAAAAAACAGATGTTAAGCAACCAGACTGTGTGGCGAAAGGCAAACCTTTCATGCAAGCAAGCGATCGATAATGCAGAGAAGGATGAACTGCTTCAAGGAGGCGACCCTACAAGGCAGAGAAAAGTAGCAAAGGAAAACCTGGCACAGTCAACAAGCAGCATCACAGAGAGTCTGATGGGAATCAGTCGAATGATGTCACAGCAAGTCCGGCAGAGCGAAGTATCCATGCAGACAATAGCCACATCATCACGGACCATTCAGGAAGCCAATGAGGAGTTCAAATCCATGTCAGGGACTATACAACTTGGACGAAAACTCATCACTAAGTACAACCGGCGTGAACTCACTGATAAGTTGCTCATTTTTTTGGCCTTAGCCTTATTCTTAGCAACTGTACTGTACATTTTGAAAAAAAGGCTATTTCTGTTCTTGCCCAACTTCCTTGGTACAAGTTGGCATTATTAAGAAAGCATTGGCTTATCAATTTTGTTGGCCACGAACAGGGTCACTAATCGTTCAAAATAAAAATCTTTAATTTTGCCCTTCCCCCCTTTTAAATATC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGATTCCCAGGATGTCCACGTCCGGATCTGTCATCAGGAAATCGTGAGATATGATCTGGAGATCAAAGCGCTGATCCAGGATATCAGAGAATGTCCTGGTCCTCTAAGCACCCTGAATGATCTCAATGCTCAAGTCAAGGAGAAATTACACCTGCTGAGGTTGAGAATACAGGATTTTGAACAATTGGCCAAGGAGCAGGATAAGGAATCTGACAAGCAAGCATTGCTGAAGGAGATGGAGTGTCACAAAAAACAGATGTTAAGCAACCAGACTGTGTGGCGAAAGGCAAACCTTTCATGCAAGCAAGCGATCGATAATGCAGAGAAGGATGAACTGCTTCAAGGAGGCGACCCTACAAGGCAGAGAAAAGTAGCAAAGGAAAACCTGGCACAGTCAACAAGCAGCATCACAGAGAGTCTGATGGGAATCAGTCGAATGATGTCACAGCAAGTCCGGCAGAGCGAAGTATCCATGCAGACAATAGCCACATCATCACGGACCATTCAGGAAGCCAATGAGGAGTTCAAATCCATGTCAGGGACTATACAACTTGGACGAAAACTCATCACTAAGTACAACCGGCGTGAACTCACTGATAAGTTGCTCATTTTTTTGGCCTTAGCCTTATTCTTAGCAACTGTACTGTACATTTTGAAAAAAAGGCTATTTCTGTTCTTGCCCAACTTCCTTGGTACAAGTTGGCATTATTAAGAAAGCATTGGCTTATCAATTTTGTTGGCCACGAACAGGGTCACTAATCGTTCAAAATAAAAATCTTTAATTTTGCCCTTCCCCCCTTTTAAATATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGATTCCCAGGATGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839253
dbEST ID: 79656955
Trimmed Sequence: GAACAGAAATAGCCTTTTTTTCAAAATGTACAGTACAGTTGCTAAGAATAAGGCTAAGGCCAAAAAAATGAGCAACTTATCAGTGAGTTCACGCCGGTTGTACTTAGTGATGAGTTTTCGTCCAAGTTGTATAGTCCCTGACATGGATTTGAACTCCTCATTGGCTTCCTGAATGGTCCGTGATGATGTGGCTATTGTCTGCATGGATACTTCGCTCTGCCGGACTTGCTGTGACATCATTCGACTGATTCCCATCAGACTCTCTGTGATGCTGCTTGTTGACTGTGCCAGGTTTTCCTTTGCTACTTTTCTCTGCCTTGTAGGGTCGCCTCCTTGAAGCAGTTCATCCTTCTCTGCATTATCGATCGCTTGCTTGCATGAAAGGTTTGCCTTTCGCCACACAGTCTGGTTGCTTAACATCTGTTTTTTGTGACACTCCATCTCCTTCAGCAATGCTTGCTTGTCAGATTCCTTATCCTGCTCCTTGGCCAATTGTTCAAAATCCTGTATTCTCAACCTCAGCAGGTGTAATTTCTCCTTGACTTGAGCATTGAGATCATTCAGGGTGCTTAGAGGACCAGGAACATCTCTGATATCCTGGATCAACGCTTTGATCTCCAGAACATATCTCAAAATTTTCCTAAAAAGAATCCGAAAGTGGACCTCCGGGGAAATTGCCATGGTGCCCAACTTTTTTGTACAAAGTTGGGCTTTATAAAAAGGCCTTGTGCTTCACAAAAATTAATGAAAAAAAAAAAAGGGCACAAAAT
Full Trace Sequence: GGGGAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAACAGAAATAGCCTTTTTTTCAAAATGTACAGTACAGTTGCTAAGAATAAGGCTAAGGCCAAAAAAATGAGCAACTTATCAGTGAGTTCACGCCGGTTGTACTTAGTGATGAGTTTTCGTCCAAGTTGTATAGTCCCTGACATGGATTTGAACTCCTCATTGGCTTCCTGAATGGTCCGTGATGATGTGGCTATTGTCTGCATGGATACTTCGCTCTGCCGGACTTGCTGTGACATCATTCGACTGATTCCCATCAGACTCTCTGTGATGCTGCTTGTTGACTGTGCCAGGTTTTCCTTTGCTACTTTTCTCTGCCTTGTAGGGTCGCCTCCTTGAAGCAGTTCATCCTTCTCTGCATTATCGATCGCTTGCTTGCATGAAAGGTTTGCCTTTCGCCACACAGTCTGGTTGCTTAACATCTGTTTTTTGTGACACTCCATCTCCTTCAGCAATGCTTGCTTGTCAGATTCCTTATCCTGCTCCTTGGCCAATTGTTCAAAATCCTGTATTCTCAACCTCAGCAGGTGTAATTTCTCCTTGACTTGAGCATTGAGATCATTCAGGGTGCTTAGAGGACCAGGAACATCTCTGATATCCTGGATCAACGCTTTGATCTCCAGAACATATCTCAAAATTTTCCTAAAAAGAATCCGAAAGTGGACCTCCGGGGAAATTGCCATGGTGCCCAACTTTTTTGTACAAAGTTGGGCTTTATAAAAAGGCCTTGTGCTTCACAAAAATTAATGAAAAAAAAAAAAGGGCACAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACAGAAATAGCCTTTTTTTCA