ORFeome > brip1 ORF1 – XORFeome v1.0

brip1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: brip1
Gene ID: 866151
Gene Page ID: 492369
ORF Xenbase ID: 17266521

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060014
Original XGC clone length: 2142

Human orthology & disease relationships

NCBI Entrez ID: 83990
Ensembl gene IDs: ENSG00000136492,LRG_300
Directly associated (OMIM) disease MIM numbers: 114480,609054
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,151623,608089

Library Location

Plate ID: GDExl11017
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ824447
dbEST ID: 79642149
Trimmed Sequence: ATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTACATTAGCTTCAAAGCTGTGTGCAAAGAAGCAAGCATCTTTTACAACAGATCAAGATGATGATTTTCAAACTGACAGGAAAAGGATTCGCCAGTCTCATGATGAACAACTGCAGGCAAGAAAACGTCGTTGTTATGAAAAAGGTGTGCAGTTTATTGATGATGATGATGATGATCAGGATCATGTGAAGTTTGATAGTTACAATCAAAGAACAGCTATCATGGATAGTTGTGCAGAGGAAGCTATTGCTGCTTCTTCCAATCATTCTGCTGGGTCTTGCATTCTGTGTTGTTGTGGTCACACCAAAGAGGATGATAAAGCTACTGAATAGTGCAAGAAAGGAAAACGAAAAGAAAGCAAAAGCTTGCCAAAATTATTTTTTCGGTACCACGTCCA
Full Trace Sequence: ACAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATCCGTACTTTCAGAATATACAATTGGTGGGGTGAAAATCCTCTTCCCATGTAGAGCGTATCCTTCCCAGCTTGCAATGATGAATTCAATTATGAGAGGCCTGAATTGTAAACAGCACTGCTTGCTAGAAAGTCCAACTGGAAGTGGAAAAAGCTTAGCCTTGTTATGTTCTGCACTTGCATGGCAGCAGTCTTTATATGGAAAGCAGTTGGTGGATGAAAAATCAGATGAGAAAGAGTGGAAAAAAATGGAGAGAGTTACTCCATGCTGCTGTTCATGTCATTTGAAAAATTCTGATCAAACTACTTTCTCCAGTGATAGACAAATGAATTCTACAGATAACGCACCATCAAATATTTCCGGAGCTTCTAGTAACAAAACTACATTAGCTTCAAAGCTGTGTGCAAAGAAGCAAGCATCTTTTACAACAGATCAAGATGATGATTTTCAAACTGACAGGAAAAGGATTCGCCAGTCTCATGATGAACAACTGCAGGCAAGAAAACGTCGTTGTTATGAAAAAGGTGTGCAGTTTATTGATGATGATGATGATGATCAGGATCATGTGAAGTTTGATAGTTACAATCAAAGAACAGCTATCATGGATAGTTGTGCAGAGGAAGCTATTGCTGCTTCTTCCAATCATTCTGCTGGGTCTTGCATTCTGTGTTGTTGTGGTCACACCAAAGAGGATGATAAAGCTACTGAATAGTGCAAGAAAGGAAAACGAAAAGAAAGCAAAAGCTTGCCAAAATTATTTTTTCGGTACCACGTCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATCCGTACTTTCAGAATAT

Sequences - 3ʹ (reverse) EST

Accession: JZ829801
dbEST ID: 79647503
Trimmed Sequence: CAAAAAAACAATGTTCTTATATTTCACCTTGTAAGATGGCAGAAAGCACAGTATTCCATGGCTCACTGTCTGGCACACAGAGAGAAGGAGGGCCCCAATCTCATCCTGAAAATCAAAGGTCTCTGTGTGCTGAAATGTTGCACAAAGCTTTCGACCCTTAGGACCAGCCACGACAGTACCAACCCACACCTGGGATTTATGAATCACGTGGTTTGCCTCAAGCTGTATTGAAAACTTAACTCCAAGTTCAGATGAAAATGATCCCATTGGAGACAAAGTACCTGATGTTAAGACAATAGTGCGAGCATTGCTGCTTAGATCTGAGAATGCCACAGCTGGATTTAGACACCAGAAATTCAGAGTGTAGACCATAATCTTTTGTCGAATACTTCTCCTGCTTCTAGGTCTTGCAAAAAATCCATTTTCATCTGGAATATCTGGTCTGTTTGTCCATGTATATGATTGCTGAAGGGCAACTCTATAATCTTCTGCAAACCTGTTATTCTGACGAAAGAGGTAGTCCAAAACCAGAAACAGGCCCTTTAAAACCATCTGTGATTGTGGACTGAGTGTAGGAATTTTAATTACATTTTCCTGCCCATGGAACATAGTTATCTTCTCTTCTTTTTCACCACAGCAGCAAGATTAACTTTCAGCAGAAGGAAAGGTTGCATTTTGTATGCCCATGTCATGAAAAAATTGAGAGAATTTCTTTACCCTTTTCCCAATTTTGCAAGGAAAGCCTTCAAATTTCCCTTTTTC
Full Trace Sequence: TGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAAAAACAATGTTCTTATATTTCACCTTGTAAGATGGCAGAAAGCACAGTATTCCATGGCTCACTGTCTGGCACACAGAGAGAAGGAGGGCCCCAATCTCATCCTGAAAATCAAAGGTCTCTGTGTGCTGAAATGTTGCACAAAGCTTTCGACCCTTAGGACCAGCCACGACAGTACCAACCCACACCTGGGATTTATGAATCACGTGGTTTGCCTCAAGCTGTATTGAAAACTTAACTCCAAGTTCAGATGAAAATGATCCCATTGGAGACAAAGTACCTGATGTTAAGACAATAGTGCGAGCATTGCTGCTTAGATCTGAGAATGCCACAGCTGGATTTAGACACCAGAAATTCAGAGTGTAGACCATAATCTTTTGTCGAATACTTCTCCTGCTTCTAGGTCTTGCAAAAAATCCATTTTCATCTGGAATATCTGGTCTGTTTGTCCATGTATATGATTGCTGAAGGGCAACTCTATAATCTTCTGCAAACCTGTTATTCTGACGAAAGAGGTAGTCCAAAACCAGAAACAGGCCCTTTAAAACCATCTGTGATTGTGGACTGAGTGTAGGAATTTTAATTACATTTTCCTGCCCATGGAACATAGTTATCTTCTCTTCTTTTTCACCACAGCAGCAAGATTAACTTTCAGCAGAAGGAAAGGTTGCATTTTGTATGCCCATGTCATGAAAAAATTGAGAGAATTTCTTTACCCTTTTCCCAATTTTGCAAGGAAAGCCTTCAAATTTCCCTTTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAAAAACAATGTTCT