ORFeome > brk1 ORF2 – XORFeome v1.0

brk1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: brk1
Gene ID: 1009803
Gene Page ID: 1009797
ORF Xenbase ID: 17266539

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128952
Original XGC clone length: 228

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCAATCCGGAGGATCCGCTGCACACGGAGATTCTCCATGATTGTGCCAAACGGGAGTACTTTGAGGTGATCACCATCAGCATCAAAAAAATCACCTACTTCTTGAACTCATTTCATATGTCTTGTCCCTCACTACTGGCGACACTAAATGAAAAGCTGACCACATTAGATAGAAGAATTGAGTATATAGAAGCACGGGTGACCAAAGGTGAAACGCTGACATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTAAAAAAAAAAAAAAAATTACAATTCTTTCCGGCAACCAAAAAAACCCAGGGGCAAAAATCCCCCACTTCCCCGCCCACACAGGGGGCGGTGTTGTTTTCTTTTTGGTATCAAAAGGAAGGGCCCACAAAAGAAAAAAAACGCGTGGGGGGTTAGTGGGGTTTTTGACAAAGGGGACCCACCCCCCCACCGGGTCCCAAAAAATAAAAAACAAAAAGGGGGTAGGGCCACCGGCGTTGTTTCTTAAAAATTAATAACTAATTATATTTGTGGAAACCCACCACCCTTGCCGATTCTCCGGCGTTTTTCTATGCTTTTTTTTTTTTGAATTACCCTAACTTACGCACACAGCAAAAAAAAACACGAGAGAGCCATTTTATTCAATAGTGTGAGGTAGAAATGATTGTGGTTAAGGAGGACCCCCCGGAGGTTTTGTTAN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAGTCAGGAGGATCCAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838953
dbEST ID: 79656655
Trimmed Sequence: TGTCAGCGTTTCACCTTTGGTCACCCGTGCTTCTATATACTCAATTCTTCTCTCTAATGTGGTCAGCTTTTCATTTAGTGTTGCCAGTCGTGAGCGACAAGACATATCACATGAGTTCAAGAAGTCGGCGATTTTCTTGATGCTGCTGGTGATCACCTCAATGTACTCCCGGTTGGCCCAATCCTGGTGAATCTCCCTCTGCACTGGATCCTCCTGACTGACCATGG
Full Trace Sequence: GGGAAAAGTCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGTCAGCGTTTCACCTTTGGTCACCCGTGCTTCTATATACTCAATTCTTCTCTCTAATGTGGTCAGCTTTTCATTTAGTGTTGCCAGTCGTGAGCGACAAGACATATCACATGAGTTCAAGAAGTCGGCGATTTTCTTGATGCTGCTGGTGATCACCTCAATGTACTCCCGGTTGGCCCAATCCTGGTGAATCTCCCTCTGCACTGGATCCTCCTGACTGACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCAAGCTTAATACTGGCCGTCGAAAAAAAACAAAGTGAGATAGCTTTTCCGGGAAAAAAGCAACCGTGCGGAGAAATAGCCGAAATCTCGCATCCCCCAGGGTCCGTTTATATTTTAGGGTTGAGTGGAAGAAGCGCCCCACCAATGAAACAGGGCGTGGGGGGGAAAAGGCNGCCGGAAAAAGACAACCCCGCACGGCNGGGAAAAAAAGGGGGGGAAGAAGGAGGGGGGGGAGAGGGGAGGGANNGNTTTNGGNGGGGGNGAGGGGNNNGGGNNGGNGGNNNNGNGNNNNNNGNNGNNNNNNNGNGGGNNNNNGNNNNNNNNNNNNNNGNNNNNNGNNNNNNNNGNNNNNNNNGNNANNNNNNNNNNNNNNNGGNNNNGGGGNNNNNNNNGNNNNNGGNNNNGNNNGNGNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCAGCGTTTCACCTTTGGTC