ORFeome > bsg ORF1 – XORFeome v1.0

bsg ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bsg
Gene ID: 6079214
Gene Page ID: 5901794
ORF Xenbase ID: 17266581

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099064
Original XGC clone length: 813

Human orthology & disease relationships

NCBI Entrez ID: 682
Ensembl gene IDs: ENSG00000172270
Directly associated (OMIM) disease MIM numbers: 111380
Indirectly associated (Lage, et al.) disease MIM numbers: 111380,117000,145600,192605,600996,604772

Library Location

Plate ID: GDExl11089
Well Location: F09

Sequences - 5ʹ (forward) EST

Accession: JZ838419
dbEST ID: 79656121
Trimmed Sequence: ATGGGTCTCGGGCTGCTTACGCTGCCCGCTGTACTGTTGCTGTTATGTGGGAGAAGAACTGAATGTACAGATCCAGATATTACAACAAATGCCGTATATATGTCGGAGAAAACAGTGATTCTGAGCTGTAACTTGTCTGTTAATTCTCTTATTGTCTCTGGCCACCGGTGGCTGAAGGGCAGTAAGGTCCTTCATGAAAATAAGGACACTTCTAATGTCATGACTTACAATGTTACAGGGCTGCCTGGTGATGGCTCAGGACAGTACACATGTGAATTCTTGACTACACCTGATGTGCGCATGGTTGTTAATGTGTCAGTTTCACCCCAAGTGCTGCACCTAAAAGCAAGTGAGCATGGCAATGAGGGAGATACAGGTGTTCTGACCTGCCAAAGCAATTCCTTCCCACCTGTGACAGACTGGGCCTGGTACATTGTTTCTCCTAATGCAGTAGAGGTCATAGGAAATGGAAGCTCAAATCGTTATGTTATAAAATCGACGGGCAATCAGACTGTGCTGAGGATAAGTAATGTGGATATTGAGAAGGACAAAAATGAGTACACTTTCCATGCCACAAATGAGCTTGGTAACTGTGGGAATGGAATACATTTCAAAGTGAAAAGTCGTCCGGGCAGCTCTCTGACCCTTCCTGGGCATTTTTTGGAAAAGTTGGGGGTAGGGTTATCATAAAATTTTAACTTATGAAAAAAAGAAAAAAACCCTAATAAATTTGTGTTAATGAATGAAGAAT
Full Trace Sequence: CGAGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGTCTCGGGCTGCTTACGCTGCCCGCTGTACTGTTGCTGTTATGTGGGAGAAGAACTGAATGTACAGATCCAGATATTACAACAAATGCCGTATATATGTCGGAGAAAACAGTGATTCTGAGCTGTAACTTGTCTGTTAATTCTCTTATTGTCTCTGGCCACCGGTGGCTGAAGGGCAGTAAGGTCCTTCATGAAAATAAGGACACTTCTAATGTCATGACTTACAATGTTACAGGGCTGCCTGGTGATGGCTCAGGACAGTACACATGTGAATTCTTGACTACACCTGATGTGCGCATGGTTGTTAATGTGTCAGTTTCACCCCAAGTGCTGCACCTAAAAGCAAGTGAGCATGGCAATGAGGGAGATACAGGTGTTCTGACCTGCCAAAGCAATTCCTTCCCACCTGTGACAGACTGGGCCTGGTACATTGTTTCTCCTAATGCAGTAGAGGTCATAGGAAATGGAAGCTCAAATCGTTATGTTATAAAATCGACGGGCAATCAGACTGTGCTGAGGATAAGTAATGTGGATATTGAGAAGGACAAAAATGAGTACACTTTCCATGCCACAAATGAGCTTGGTAACTGTGGGAATGGAATACATTTCAAAGTGAAAAGTCGTCCGGGCAGCTCTCTGACCCTTCCTGGGCATTTTTTGGAAAAGTTGGGGGTAGGGTTATCATAAAATTTTAACTTATGAAAAAAAGAAAAAAACCCTAATAAATTTGTGTTAATGAATGAAGAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTCTCGGGCTGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838418
dbEST ID: 79656120
Trimmed Sequence: GTTTGAATTCCTCTGGCGCAGGTTGTCATTGTTTGCACCGGAATTACTTTTCAGAGCACCTGTTGCAGAGTCTTCATCTTCACACACCTCATCAGGCTTTCTCCTCTTCTCATAGATAAATATTATTGTAACCAGTACCACCACTTCTCCAACAATGCCCAAGAATGGCCAGAGAGCTGCCAGACGACTTCTCACTTTGAAATGTATTACATCCCCACCAGTACCAAGCTCATTTGTGGCATTGCACGTGTACTCATTTTGGTCCTTCTCAATATCCACATTACTTATCCTCAGCACAGTCTGATTGCCCGTCGATTTTATAACATAACGATCTGAGCTTCCATTTCCTATGACCTCTACTGCATTAGGAGAAACAATGTACCAGGCCCAGTCTGTCACAGGTGGGAAGGAATTGCTTTGGCAGGTCAGAACACCTGTATCTCCCTCATTGCCATGCTCACTTGCTTTTAAGTGCAGCACTTGGGGTGAAACGGACACATTAACAACCATGCGCCCCTCAGGTGTAGGTCAGGAATTCACATGTGTAGGGGCCGGAGGCCGCACCAGGCAGCCCCTGAACATTGTAAGTCCTGACGTTAGAAGTGTCCCTGATCTTTTTGGACGACGGGAGTGGCCGTCCGACGCCGGGGGGGCGAAAAACAAAAAGAAAAATAAACAAAAAGAATTAAAGGGTAGAAAGGGTTAGTTTTCGTCGGGCGAAATTACCGCGAGTTG
Full Trace Sequence: GGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTGAATTCCTCTGGCGCAGGTTGTCATTGTTTGCACCGGAATTACTTTTCAGAGCACCTGTTGCAGAGTCTTCATCTTCACACACCTCATCAGGCTTTCTCCTCTTCTCATAGATAAATATTATTGTAACCAGTACCACCACTTCTCCAACAATGCCCAAGAATGGCCAGAGAGCTGCCAGACGACTTCTCACTTTGAAATGTATTACATCCCCACCAGTACCAAGCTCATTTGTGGCATTGCACGTGTACTCATTTTGGTCCTTCTCAATATCCACATTACTTATCCTCAGCACAGTCTGATTGCCCGTCGATTTTATAACATAACGATCTGAGCTTCCATTTCCTATGACCTCTACTGCATTAGGAGAAACAATGTACCAGGCCCAGTCTGTCACAGGTGGGAAGGAATTGCTTTGGCAGGTCAGAACACCTGTATCTCCCTCATTGCCATGCTCACTTGCTTTTAAGTGCAGCACTTGGGGTGAAACGGACACATTAACAACCATGCGCCCCTCAGGTGTAGGTCAGGAATTCACATGTGTAGGGGCCGGAGGCCGCACCAGGCAGCCCCTGAACATTGTAAGTCCTGACGTTAGAAGTGTCCCTGATCTTTTTGGACGACGGGAGTGGCCGTCCGACGCCGGGGGGGCGAAAAACAAAAAGAAAAATAAACAAAAAGAATTAAAGGGTAGAAAGGGTTAGTTTTCGTCGGGCGAAATTACCGCGAGTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTGAATTCCTCTGGCGCAGGT