ORFeome > btf3l4 ORF1 – XORFeome v1.0

btf3l4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: btf3l4
Gene ID: 948242
Gene Page ID: 948235
ORF Xenbase ID: 17266605

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099245
Original XGC clone length: 477

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ840059
dbEST ID: 79657761
Trimmed Sequence: ATGAATCAAGAAAAGTTAGCAAAGCTTCAAGCACAAGTCCGAATAGGTGGAAAGGGCACAGCCCGCAGAAAGAAGAAGGTCGTGCACAGAACAGCAACCGCAGATGACAAGAAACTTCAGAGTTCCCTCAAGAAATTGGCAGTGAATAATATCGCTGGCATTGAAGAGGTGAATATGATTAAAGATGATGGTACCGTTATCCATTTCAACAACCCTAAGGTCCAGGCTTCACTCTCTGCCAACACGTTTGCAATTACTGGCCACGCAGAAGTAAAACAGATAACAGAAATGCTGCCAGGGATCCTCAGCCAGCTGGGAGCAGACAGCCTCACAAGTCTACGCAAGTTAGCTGAACAATTTCCCAGACAGGTTTTGGATAGCAAAGCATCCAAACCTGAGGACATAGAGGAGGAGGACGATGATGTTCCTGAACTTGTAGGGAACTTTGATGAAGCATCAAAGAATGAAGCTAACTT
Full Trace Sequence: GGAGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCAAGAAAAGTTAGCAAAGCTTCAAGCACAAGTCCGAATAGGTGGAAAGGGCACAGCCCGCAGAAAGAAGAAGGTCGTGCACAGAACAGCAACCGCAGATGACAAGAAACTTCAGAGTTCCCTCAAGAAATTGGCAGTGAATAATATCGCTGGCATTGAAGAGGTGAATATGATTAAAGATGATGGTACCGTTATCCATTTCAACAACCCTAAGGTCCAGGCTTCACTCTCTGCCAACACGTTTGCAATTACTGGCCACGCAGAAGTAAAACAGATAACAGAAATGCTGCCAGGGATCCTCAGCCAGCTGGGAGCAGACAGCCTCACAAGTCTACGCAAGTTAGCTGAACAATTTCCCAGACAGGTTTTGGATAGCAAAGCATCCAAACCTGAGGACATAGAGGAGGAGGACGATGATGTTCCTGAACTTGTAGGGAACTTTGATGAAGCATCAAAGAATGAAGCTAACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTTACATGAACAAAAAAAGTTACATAAAAAAATACTAGCAAGTGTCTCATACCCCAAAAAAGATACAGGAAAGGGGGAAAAATTTCCTTGGAGGCCCGGGGGGGGGGGGGGGGCCCCCTTTTTTAAAATGTGGTTGGGTGGGAACCCCCGTCCCCCAAAACAGCTAAATCCCCCCACGGAGAAGAAAAAAATAAAGAGTGGGACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCAAGAAAAGTTAGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ840058
dbEST ID: 79657760
Trimmed Sequence: GTTAGCTTCATTCTTTGATGCTTCATCAAAGTTCCCTACAAGTTCAGGAACATCATCGTCCTCCTCCTCTATGTCCTCAGGTTTGGATGCTTTGCTATCCAAAACCTGTCTGGGAAATTGTTCAGCTAACTTGCGTAGACTTGTGAGGCTGTCTGCTCCCAGCTGGCTGAGGATCCCTGGCAGCATTTCTGTTATCTGTTTTACTTCTGCGTGGCCAGTAATTGCAAACGTGTTGGCAGAGAGTGAAGCCTGGACCTTAGGGTTGTTGAAATGGATAACGGTACCATCATCTTTAATCATATTCACCTCTTCAATGCCAGCGATATTATTCACTGCCAATTTCTTGAGGGAACTCTGAAGTTTCTTGTCATCTGCGGTTGCTGTTCTGTGCACGACCTTCTTCTTTCTGCGGGCTGTGCCCTTTCCACCTATTCGGACTTGTGCTTGAAGCTTTGCTAACTTTTCTTGATTCATGG
Full Trace Sequence: GAAGACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTAGCTTCATTCTTTGATGCTTCATCAAAGTTCCCTACAAGTTCAGGAACATCATCGTCCTCCTCCTCTATGTCCTCAGGTTTGGATGCTTTGCTATCCAAAACCTGTCTGGGAAATTGTTCAGCTAACTTGCGTAGACTTGTGAGGCTGTCTGCTCCCAGCTGGCTGAGGATCCCTGGCAGCATTTCTGTTATCTGTTTTACTTCTGCGTGGCCAGTAATTGCAAACGTGTTGGCAGAGAGTGAAGCCTGGACCTTAGGGTTGTTGAAATGGATAACGGTACCATCATCTTTAATCATATTCACCTCTTCAATGCCAGCGATATTATTCACTGCCAATTTCTTGAGGGAACTCTGAAGTTTCTTGTCATCTGCGGTTGCTGTTCTGTGCACGACCTTCTTCTTTCTGCGGGCTGTGCCCTTTCCACCTATTCGGACTTGTGCTTGAAGCTTTGCTAACTTTTCTTGATTCATGGTGCCGACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACCAACTGGTCACTATCAGTCAAAATAAAATCATAAAAAAAAAACGAAAAAAAAAACTAGACCATGCGTTCTACAAGAAGGGGAAGAGGGAGATGGTAAAAAATCCAAGTGGCCGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTAGCTTCATTCTTTGATGCTTC