ORFeome > btg1 ORF1 – XORFeome v1.0

btg1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: btg1
Gene ID: 1002926
Gene Page ID: 1002919
ORF Xenbase ID: 17266611

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053755
Original XGC clone length: 510

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ839401
dbEST ID: 79657103
Trimmed Sequence: ATGCATACGCACTATCCCTGGGCCAACATGAAGCCAGAGATCATGGCGGCGGTGAGTTTCATCACGAAGTTCCTCCGAACCAAAGGCCTCATGAACGACCTCGACCTGCAGACGTTCAACCAGTCCCTGCAGGAGATGCTGGCCGATCACTATAAGCATCATTGGTTTCCAGAAAAGCCATCTAGGGGTTCGGCCTATCGTTGTATTCGGATTAACCACAAGATGGACCCTTTAGTTGGACAGGCAGCAGACCGTATTGGACTCAGCAGCCAGGCAATGTTTAAACTTCTGCCAAGTGAACTTACTTTGTGGGTTGACCCATATGAAGTATCGTACCGCATAGGAGAAGATGGTTCTATATGTGTATTGTATGAATCTGTTCCAGGAGTTGGTGTCGGTCCAAACAGCGTTGGCTCTCTAGTTGAGAGTAGGATCAGCTGTAAAGATGAACTCCTCTTGGGCCGAACAAGCCCATCCCAAACATACAACATGATGACTGTATCTGGTTT
Full Trace Sequence: TCGTGGGCCCAATAAGTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCATACGCACTATCCCTGGGCCAACATGAAGCCAGAGATCATGGCGGCGGTGAGTTTCATCACGAAGTTCCTCCGAACCAAAGGCCTCATGAACGACCTCGACCTGCAGACGTTCAACCAGTCCCTGCAGGAGATGCTGGCCGATCACTATAAGCATCATTGGTTTCCAGAAAAGCCATCTAGGGGTTCGGCCTATCGTTGTATTCGGATTAACCACAAGATGGACCCTTTAGTTGGACAGGCAGCAGACCGTATTGGACTCAGCAGCCAGGCAATGTTTAAACTTCTGCCAAGTGAACTTACTTTGTGGGTTGACCCATATGAAGTATCGTACCGCATAGGAGAAGATGGTTCTATATGTGTATTGTATGAATCTGTTCCAGGAGTTGGTGTCGGTCCAAACAGCGTTGGCTCTCTAGTTGAGAGTAGGATCAGCTGTAAAGATGAACTCCTCTTGGGCCGAACAAGCCCATCCCAAACATACAACATGATGACTGTATCTGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCTTCCACCTGATATCCCCTAAAGTGAGTCGTATTACATGGTTCAAACCTGTTTCAAAAAAAAACAAAGGCCCGGTCTCAAAAACCCTAAAATGTTAAAAAAAGCGCGGGGTAAAAAATCCCTCCCCCCTCTCNCCAACACACGGGGGGGCTCGGGGGTTAATCCCGGATGTGGGAAAGGGGAAAAGACGACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATACGCACTATCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839400
dbEST ID: 79657102
Trimmed Sequence: ACCAGATACAGTCATCATGTTGTATGTTTTGGATGGGCTTGTTCGGCCCAAGAGGAGTTCATCTTTACAGCTGATCCTACTCTCAACTAGAGAGCCAACGCTGTTTGGACCGACACCAACTCCTGGAACAGATTCATACAATACACATATAGAACCATCTTCTCCTATGCGGTACGATACTTCATATGGGTCAACCCACAAAGTAAGTTCACTTGGCAGAAGTTTAAACATTGCCTGGCTGCTGAGTCCAATACGGTCTGCTGCCTGTCCAACTAAAGGGTCCATCTTGTGGTTAATCCGAATACAACGATAGGCCGAACCCCTAGATGGCTTTTCTGGAAACCAATGATGCTTATAGTGATCGGCCAGCATCTCCTGCAGGGACTGGTTGAACGTCTGCAGGTCGAGGTCGTTCATGAGGCCTTTGGTTCGGAGGAACTTCGTGATGAAACTCACCGCCGCCATGATCTCTGGCTTCATGTTGGCCCAGGGATAGTGCGTATGCATGG
Full Trace Sequence: CGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCAGATACAGTCATCATGTTGTATGTTTTGGATGGGCTTGTTCGGCCCAAGAGGAGTTCATCTTTACAGCTGATCCTACTCTCAACTAGAGAGCCAACGCTGTTTGGACCGACACCAACTCCTGGAACAGATTCATACAATACACATATAGAACCATCTTCTCCTATGCGGTACGATACTTCATATGGGTCAACCCACAAAGTAAGTTCACTTGGCAGAAGTTTAAACATTGCCTGGCTGCTGAGTCCAATACGGTCTGCTGCCTGTCCAACTAAAGGGTCCATCTTGTGGTTAATCCGAATACAACGATAGGCCGAACCCCTAGATGGCTTTTCTGGAAACCAATGATGCTTATAGTGATCGGCCAGCATCTCCTGCAGGGACTGGTTGAACGTCTGCAGGTCGAGGTCGTTCATGAGGCCTTTGGTTCGGAGGAACTTCGTGATGAAACTCACCGCCGCCATGATCTCTGGCTTCATGTTGGCCCAGGGATAGTGCGTATGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAAGTCACTATCAGTCCAATTAAATCATTAAATAGAGAACCAAACTAAAAACGGCCGTCGTTTCACCTCTTTTGGACCTGGAATTTTCCCTGCCGGCCTCGCGTCGGTTGTCGCCATGTGTTNGGAATTTTNACAAAGGGGGAAGAGGGAGACANACANCCCANN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAGATACAGTCATCATGTTG