ORFeome > btn2a2 ORF1 – XORFeome v1.0

btn2a2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: btn2a2
Gene ID: 5825429
Gene Page ID: 5825401
ORF Xenbase ID: 17266647

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129539
Original XGC clone length: 930

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ837900
dbEST ID: 79655602
Trimmed Sequence: ATGACTGCACTCAGTATTAACCTGTTATTCACAGTCTCTATCACAAGCTCACTCATCCAGGCTTCACTGTCAGAGAGGTTCCAGGTCATCCCCACCAAGTCCCCAGTAACCGCCATCCTTGGCTCCAGCGTTGAGCTCAACTGCCATCTGTTTCCTGAAATGAATGCTGAAAAGATGGAAATCCGATGGCTACGAAATTCCTTCCGTCCCTACGTCCACTTGTATCTGAATGGGGAGGATAACTACAGGGAGCAGATGGAGGAATTCCGAGGCAGGACAGAGTTCCTCAAGCAGAACATCAATAGGGGGATCGGGGCTCTAACTATTCACAAGGTGCAGTTGTCGGATCAGGGATTGTACACCTGCTATTTTGAGTCAGAGAGCAATCATAACCAAGCACAAGTGGAACTCAAAGTAGCAGCCATGGGCCTCCATCCTTTCATCTGGGTTGAAGATTACCAGAATGGAAAAATAACACTAAACTGTGAATCCAGTGGTTGGTACCCTAAGCCCACAGCAATGTGGCAAGATGAATCTGGGACCCGGTTGGAATCAACGGAGAAGATAAATGTCACTGGAGAAACGGGTCTGTTCCACGTCACCTCTGCTATCAGTATAGAGACCCAGGACAAGATCTCCTGCTATGTTAGAAATGACCTCCTGGGAAGATGGCAAAGAGTCTTCTATTAATTTTGCAAAATCTTTTCACTGAAAAGTGGAACGTAAATGGGAACCCCCCCTTTTTTCCCCCTGGCTTTCCTTTTTTTGGCTTTGGCCACTTTTTAAACCAAATGGGGGGTTAACTCCC
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTGCACTCAGTATTAACCTGTTATTCACAGTCTCTATCACAAGCTCACTCATCCAGGCTTCACTGTCAGAGAGGTTCCAGGTCATCCCCACCAAGTCCCCAGTAACCGCCATCCTTGGCTCCAGCGTTGAGCTCAACTGCCATCTGTTTCCTGAAATGAATGCTGAAAAGATGGAAATCCGATGGCTACGAAATTCCTTCCGTCCCTACGTCCACTTGTATCTGAATGGGGAGGATAACTACAGGGAGCAGATGGAGGAATTCCGAGGCAGGACAGAGTTCCTCAAGCAGAACATCAATAGGGGGATCGGGGCTCTAACTATTCACAAGGTGCAGTTGTCGGATCAGGGATTGTACACCTGCTATTTTGAGTCAGAGAGCAATCATAACCAAGCACAAGTGGAACTCAAAGTAGCAGCCATGGGCCTCCATCCTTTCATCTGGGTTGAAGATTACCAGAATGGAAAAATAACACTAAACTGTGAATCCAGTGGTTGGTACCCTAAGCCCACAGCAATGTGGCAAGATGAATCTGGGACCCGGTTGGAATCAACGGAGAAGATAAATGTCACTGGAGAAACGGGTCTGTTCCACGTCACCTCTGCTATCAGTATAGAGACCCAGGACAAGATCTCCTGCTATGTTAGAAATGACCTCCTGGGAAGATGGCAAAGAGTCTTCTATTAATTTTGCAAAATCTTTTCACTGAAAAGTGGAACGTAAATGGGAACCCCCCCTTTTTTCCCCCTGGCTTTCCTTTTTTTGGCTTTGGCCACTTTTTAAACCAAATGGGGGGTTAACTCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTGCACTCAGTATTAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ837899
dbEST ID: 79655601
Trimmed Sequence: ATTCAGTCTGTCCAGTTTGTTCTCCAGTCGGTTCCAAACATCCTGTGCTCGGATCCAAACTTTGTCCACTTTATCTGAAAGTTTTCCCATATCATTTTGGAGAGTTCTTATTCTAAACATGCGCACTACTTGAGGAGTAACCCCAATCGTTATAAGTGCCACAGCCAAACAAGAAGCCATGAGAACAAAGCGAGAGATCCCACTACGATCCACTCTCCAGTAGAAAGACTCTGCAAACTTAATAGAAGACTCTTTGCCATCTTCCAGGAGGTCATTTCTAACATAGCAGGAGATCTTGTCCTGGGTCTCTATACTGATAGCAGAGGTGACGTGGAACAGACCCGTTTCTCCAGTGACATTTATCTTCTCCGTTGATTCCAACCGGGTCCCAGATTCATCTTGCCACATTGCTGTGGGCTTAGGGTACCAACCACTGGATTCACAGTTTAGTGTTATTTTTCCATTCTGGTAATCTTCAACCCAGATGAAAGGATGGAGGCCCATGGCTGCTACTTTGAGTTCCACTTGTGCTTGGTTATGATTGCTCTCTGACTCAAAATAGCAGGTGTACAATCCCTGATCCGACAACTGCACCTTGTGAATAGTTAGAGCCCCGATCCCCCTATTGATGTTCTGCTTGAGGAACTCTGTCCTGCCTCGGAATTCCTCCATCTGCTCCCTGTAGTTATCCTCCCCATTTAGAATACAAGTGGACGTAGGGACGGAAAGAATTTCCTAGCCCTCGGATTTTCATCTTTTTCGCCATTCTTTCCAGAAAACAAAAAGCAATTTAAGCTCACCCTGGAGCCAAGGAAAGGGGGTAACTGGGGACTGGGTGGGGATGACCTGGAACCTCCTCTAAAATAAAAGCTGGAATAAAGGAGGTTGGGAATAAAAACGGGTAAAAAAAAGGTTAAAAACAAAGATGAATTCCTTGGGGCCAACTTTCTTTGTAACAAATTAGGGCAATAAGAAAAAAAACATACAATCAAACGATTTGTTTGGCAACAAAAAGGGGGTGCGCTATCAAGTCAAAAAAAAAAAAAAACAATAAAATAGAAGATCCTCTAATATCGCAAAAAGAAGGGCCCGGTCGTTTTTAAAAAAACAGACCCATCGAACACACCCGGGGGCAGAGCGGCNCCCGCCGGGGGCTGAGAGGGGGATAGATAGGTAGTTATCTTGATTTTATTGTTTGTGTGGATTTGAAGAAGAATAATAGNAAGACNACGA
Full Trace Sequence: CGGGCGAGCAAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCAGTCTGTCCAGTTTGTTCTCCAGTCGGTTCCAAACATCCTGTGCTCGGATCCAAACTTTGTCCACTTTATCTGAAAGTTTTCCCATATCATTTTGGAGAGTTCTTATTCTAAACATGCGCACTACTTGAGGAGTAACCCCAATCGTTATAAGTGCCACAGCCAAACAAGAAGCCATGAGAACAAAGCGAGAGATCCCACTACGATCCACTCTCCAGTAGAAAGACTCTGCAAACTTAATAGAAGACTCTTTGCCATCTTCCAGGAGGTCATTTCTAACATAGCAGGAGATCTTGTCCTGGGTCTCTATACTGATAGCAGAGGTGACGTGGAACAGACCCGTTTCTCCAGTGACATTTATCTTCTCCGTTGATTCCAACCGGGTCCCAGATTCATCTTGCCACATTGCTGTGGGCTTAGGGTACCAACCACTGGATTCACAGTTTAGTGTTATTTTTCCATTCTGGTAATCTTCAACCCAGATGAAAGGATGGAGGCCCATGGCTGCTACTTTGAGTTCCACTTGTGCTTGGTTATGATTGCTCTCTGACTCAAAATAGCAGGTGTACAATCCCTGATCCGACAACTGCACCTTGTGAATAGTTAGAGCCCCGATCCCCCTATTGATGTTCTGCTTGAGGAACTCTGTCCTGCCTCGGAATTCCTCCATCTGCTCCCTGTAGTTATCCTCCCCATTTAGAATACAAGTGGACGTAGGGACGGAAAGAATTTCCTAGCCCTCGGATTTTCATCTTTTTCGCCATTCTTTCCAGAAAACAAAAAGCAATTTAAGCTCACCCTGGAGCCAAGGAAAGGGGGTAACTGGGGACTGGGTGGGGATGACCTGGAACCTCCTCTAAAATAAAAGCTGGAATAAAGGAGGTTGGGAATAAAAACGGGTAAAAAAAAGGTTAAAAACAAAGATGAATTCCTTGGGGCCAACTTTCTTTGTAACAAATTAGGGCAATAAGAAAAAAAACATACAATCAAACGATTTGTTTGGCAACAAAAAGGGGGTGCGCTATCAAGTCAAAAAAAAAAAAAAACAATAAAATAGAAGATCCTCTAATATCGCAAAAAGAAGGGCCCGGTCGTTTTTAAAAAAACAGACCCATCGAACACACCCGGGGGCAGAGCGGCNCCCGCCGGGGGCTGAGAGGGGGATAGATAGGTAGTTATCTTGATTTTATTGTTTGTGTGGATTTGAAGAAGAATAATAGNAAGACNACGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCAGTCTGTCCAGTTTGTTC