ORFeome > bud31 ORF1 – XORFeome v1.0

bud31 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bud31
Gene ID: 961910
Gene Page ID: 961903
ORF Xenbase ID: 17266671

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC040971
Original XGC clone length: 435

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: F02

Sequences - 5ʹ (forward) EST

Accession: JZ823704
dbEST ID: 79641406
Trimmed Sequence: ATGCCAAAAGTAAAGCGGAGCAGAAAGCCTCCACCAGATGGATGGGAGCTCATTGAGCCAACCTTAGATGAACTTGACCAGAAAATGAGAGAGGCGGAAACTGATCCCCATGAGGGAAAGAGAAAAGTAGAGTCCTTGTGGCCGATCTTCAGGATTCATCATCAGAAAACTCGCTATATCTTTGACCTATTTTACAAGAGAAAAGCCATCAGCAGAGAGCTATACGACTACTGCATCAGGGAAGGATATGCTGATAAGAACCTCATTGCAAAATGGAAAAAACAGGGCTATGAAAACCTGTGTTGCCTGCGCTGTATACAGACCAGAGACACCAACTTTGGGACCAATTGTATTTGCAGGGTCCCAAAAACCAAACTGGAAGTGGGGAGGATCATTGAGTGCACACACTGTGGCTGCAGAGGATGCTCTGGATT
Full Trace Sequence: GGGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCAAAAGTAAAGCGGAGCAGAAAGCCTCCACCAGATGGATGGGAGCTCATTGAGCCAACCTTAGATGAACTTGACCAGAAAATGAGAGAGGCGGAAACTGATCCCCATGAGGGAAAGAGAAAAGTAGAGTCCTTGTGGCCGATCTTCAGGATTCATCATCAGAAAACTCGCTATATCTTTGACCTATTTTACAAGAGAAAAGCCATCAGCAGAGAGCTATACGACTACTGCATCAGGGAAGGATATGCTGATAAGAACCTCATTGCAAAATGGAAAAAACAGGGCTATGAAAACCTGTGTTGCCTGCGCTGTATACAGACCAGAGACACCAACTTTGGGACCAATTGTATTTGCAGGGTCCCAAAAACCAAACTGGAAGTGGGGAGGATCATTGAGTGCACACACTGTGGCTGCAGAGGATGCTCTGGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCCAACATCTATAAAAATTTAAACNNNNNGGGGGGGGTCTTCGGGGCGCCGCCTTTCTCCCCCGGTTTGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAAAAGTAAAGCGGAGCAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829014
dbEST ID: 79646716
Trimmed Sequence: TCCAGAGCATCCTCTGCAGCCACAGTGTGTGCACTCAATGATCCTCCCCACTTCCAGTTTGGTTTTTGGGACCCTGCAAATACAATTGGTCCCAAAGTTGGTGTCTCTGGTCTGTATACAGCGCAGGCAACACAGGTTTTCATAGCCCTGTTTTTTCCATTTTGCAATGAGGTTCTTATCAGCATATCCTTCCCTGATGCAGTAGTCGTATAGCTCTCTGCTGATGGCTTTTCTCTTGTAAAATAGGTCAAAGATATAGCGAGTTTTCTGATGATGAATCCTGAAGATCGGCCACAAGGACTCTACTTTTCTCTTTCCCTCATGGGGATCAGTTTCCGCCTCTCTCATTTTCTGGTCAAGTTCATCTAAGGTTGGCTCAATGAGCTCCCATCCATCTGGTGGAGGCTTTCTGCTCCGCTTTACTTTTGGCATGG
Full Trace Sequence: AAGGGCCTGCAGGGACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCCAGAGCATCCTCTGCAGCCACAGTGTGTGCACTCAATGATCCTCCCCACTTCCAGTTTGGTTTTTGGGACCCTGCAAATACAATTGGTCCCAAAGTTGGTGTCTCTGGTCTGTATACAGCGCAGGCAACACAGGTTTTCATAGCCCTGTTTTTTCCATTTTGCAATGAGGTTCTTATCAGCATATCCTTCCCTGATGCAGTAGTCGTATAGCTCTCTGCTGATGGCTTTTCTCTTGTAAAATAGGTCAAAGATATAGCGAGTTTTCTGATGATGAATCCTGAAGATCGGCCACAAGGACTCTACTTTTCTCTTTCCCTCATGGGGATCAGTTTCCGCCTCTCTCATTTTCTGGTCAAGTTCATCTAAGGTTGGCTCAATGAGCTCCCATCCATCTGGTGGAGGCTTTCTGCTCCGCTTTACTTTTGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAAAGCCCGAGCTTAAGACTGGCCGTCGTTTTACACGCTGGGGGAACGGGGCAGTTCCCAAGTTCCCCACCGGCCAGGATAATACGATATCCTTCACAAAACAAGGAAAAATGTTCCCCCTTCGTTTACACCAGATAAAACAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCAGAGCATCCTCTGCAGCC