ORFeome > c16orf13 ORF1 – XORFeome v1.0

c16orf13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c16orf13
Gene ID: 981700
Gene Page ID: 981692
ORF Xenbase ID: 17266863

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097735
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ837141
dbEST ID: 79654843
Trimmed Sequence: ATGCTGGTGGCGACTGCAGCAGATAGGAACAAGGATCCGATCCTGGAAGTGCTGCGACAGTACGTAGACCCTGCAGCCCCCAAGGTGCGGGCTTTGGAGGTGGCATCGGGTACTGGACAACACTGCGCACACTTTGCTCGGGCATTGCCGAACCTGTATCTGGTCCCCTCAGAGCTGGACCCACGCAGTCTGCAGAGTATCTCCGCATATATCTCCCACTGGTCACTCAGTAACGTGGAGCAGCCCCGGACTCTCGATGTCTCCAAAAGCTGGGAGACTTGGGGCTTTAAACCCAATTCACTGCAACTCATTATCTGCATCAACATGATCCATATCTCTGAGCCTAGCTGCACACAGGGTCTTTTTAAAGGAGCAGGCCACCTATTGCAGCCTGGAGGTGTGCTGTTTACTTATGGGCCATACTCCGTGAACGGAATCCTAACCCCACAGAGCAATGTGGATTTTAACCTTAGTCTGAAAAGCAGAAATCCTGCCTGGGGAGTGTGGGATACATCTGATCTCCAAAACCTAGCAACAGCCTGCGGGATGTCACTGGAGAGGATGGTGGATTTGCCAGCCAACAATAAATGTCTGATCTTCCGAAAGAAGTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGTGGCGACTGCAGCAGATAGGAACAAGGATCCGATCCTGGAAGTGCTGCGACAGTACGTAGACCCTGCAGCCCCCAAGGTGCGGGCTTTGGAGGTGGCATCGGGTACTGGACAACACTGCGCACACTTTGCTCGGGCATTGCCGAACCTGTATCTGGTCCCCTCAGAGCTGGACCCACGCAGTCTGCAGAGTATCTCCGCATATATCTCCCACTGGTCACTCAGTAACGTGGAGCAGCCCCGGACTCTCGATGTCTCCAAAAGCTGGGAGACTTGGGGCTTTAAACCCAATTCACTGCAACTCATTATCTGCATCAACATGATCCATATCTCTGAGCCTAGCTGCACACAGGGTCTTTTTAAAGGAGCAGGCCACCTATTGCAGCCTGGAGGTGTGCTGTTTACTTATGGGCCATACTCCGTGAACGGAATCCTAACCCCACAGAGCAATGTGGATTTTAACCTTAGTCTGAAAAGCAGAAATCCTGCCTGGGGAGTGTGGGATACATCTGATCTCCAAAACCTAGCAACAGCCTGCGGGATGTCACTGGAGAGGATGGTGGATTTGCCAGCCAACAATAAATGTCTGATCTTCCGAAAGAAGTTGCCCACTTTCTTTGTCAAAGTTGGCATTATAAAAAAACCATTGCTTATCAATTTGTTGCACCGAAACAGTTACTATCAGTCCAAAATAAAATCAATTATTTCCGTCCCACCTGATTTCAAAAAAAAAAAAAAAAAAAAATAAAATAATAAATACCGGTTTTCCTGGGCCGCTGGGGCCCAAAGTCTCAAAACCCCTCCCCCCAAAGGAGGAAAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGTGGCGACTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837140
dbEST ID: 79654842
Trimmed Sequence: CTTCTTTCGGAAGATCAGACATTTATTGTTGGCTGGCAAATCCACCATCCTCTCCAGTGACATCCCGCAGGCTGTTGCTAGGTTTTGGAGATCAGATGTATCCCACACTCCCCAGGCAGGATTTCTGCTTTTCAGACTAAGGTTAAAATCCACATTGCTCTGTGGGGTTAGGATTCCGTTCACGGAGTATGGCCCATAAGTAAACAGCACACCTCCAGGCTGCAATAGGTGGCCTGCTCCTTTAAAAAGACCCTGTGTGCAGCTAGGCTCAGAGATATGGATCATGTTGATGCAGATAATGAGTTGCAGTGAATTGGGTTTAAAGCCCCAAGTCTCCCAGCTTTTGGAGACATCGAGAGTCCGGCGCTGCTCCACGTTACTGAGTGACCAGTGGGAGATATATGCGGAGATACTCTGCAAACTGCGTGGGTCCAGCTCTGAAGGAACCAGATACAGGTTCGGCAATGCCCAAGCAAAATGTGCGCAGGGTTGTCCAGTACCCGATGCCCACCCCCAAGCCCGCACCTTGGGGGGCTGCGGGGTCTACGTACCTGTCGCGCCCTTTCAGGATGGAATGCTTGTTCCTATCTGCTTCATTCCCCACCAGCCATGATCCCAACTTGTGTGTACCAAAGTTGGGTTGGTGAAAAAACCATTAATCCTCCAGATTTGTTGCCCCCGAAGCNGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAATAAATTATAATACACTTCTAGCGCACGGACCCATCCCCTATATAAA
Full Trace Sequence: GGGAAATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCNAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTTTCGGAAGATCAGACATTTATTGTTGGCTGGCAAATCCACCATCCTCTCCAGTGACATCCCGCAGGCTGTTGCTAGGTTTTGGAGATCAGATGTATCCCACACTCCCCAGGCAGGATTTCTGCTTTTCAGACTAAGGTTAAAATCCACATTGCTCTGTGGGGTTAGGATTCCGTTCACGGAGTATGGCCCATAAGTAAACAGCACACCTCCAGGCTGCAATAGGTGGCCTGCTCCTTTAAAAAGACCCTGTGTGCAGCTAGGCTCAGAGATATGGATCATGTTGATGCAGATAATGAGTTGCAGTGAATTGGGTTTAAAGCCCCAAGTCTCCCAGCTTTTGGAGACATCGAGAGTCCGGCGCTGCTCCACGTTACTGAGTGACCAGTGGGAGATATATGCGGAGATACTCTGCAAACTGCGTGGGTCCAGCTCTGAAGGAACCAGATACAGGTTCGGCAATGCCCAAGCAAAATGTGCGCAGGGTTGTCCAGTACCCGATGCCCACCCCCAAGCCCGCACCTTGGGGGGCTGCGGGGTCTACGTACCTGTCGCGCCCTTTCAGGATGGAATGCTTGTTCCTATCTGCTTCATTCCCCACCAGCCATGATCCCAACTTGTGTGTACCAAAGTTGGGTTGGTGAAAAAACCATTAATCCTCCAGATTTGTTGCCCCCGAAGCNGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAATAAATTATAATACACTTCTAGCGCACGGACCCATCCCCTATATAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTTTCGGAAGATCAGACA