ORFeome > c16orf52 ORF1 – XORFeome v1.0

c16orf52 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: c16orf52
Gene ID: 5865835
Gene Page ID: 5865780
ORF Xenbase ID: 17266869

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054192
Original XGC clone length: 504

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ839223
dbEST ID: 79656925
Trimmed Sequence: ATGGATAAACTGACCATCATTTCTGGATGTTTGTTTCTGGCTGCGGATATCTTTGCCATCGCCAGTATCGCGAACCCCGACTGGATCAACACAGGGGAGTCTGCCGGAGCTCTCACAGTCGGCCTCGTCAGACAATGTCAGACTATTCATGGACGTGACAGAACCTGTATTCCCCCAAGGCTCCCACCTGAGTGGGTAACCACTCTGTTTTTTATCATCATGGGAATCATATCATTGACTGTTACTTGTGGCTTGCTAGTGGCCTCCCATTGGAGAAGAGAAGCTACAAAATATGCCCGCTGGATAGCGTTTACCGGCATGATCCTCTTCTGTATGGCAGCATTAATATTCCCAATAGGATTTTACATCAACGAAGTTGGAGGCCAACCCTACAAATTACCCAACAACACAGTAGTCGGATCATCTTATGTACTTTTTGTTTTATCCATTTTCTTTACAATAGTAGGACTATTATTTGCGGGCAAAGTATGTTTACCTGGTTT
Full Trace Sequence: GCTCGAGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATAAACTGACCATCATTTCTGGATGTTTGTTTCTGGCTGCGGATATCTTTGCCATCGCCAGTATCGCGAACCCCGACTGGATCAACACAGGGGAGTCTGCCGGAGCTCTCACAGTCGGCCTCGTCAGACAATGTCAGACTATTCATGGACGTGACAGAACCTGTATTCCCCCAAGGCTCCCACCTGAGTGGGTAACCACTCTGTTTTTTATCATCATGGGAATCATATCATTGACTGTTACTTGTGGCTTGCTAGTGGCCTCCCATTGGAGAAGAGAAGCTACAAAATATGCCCGCTGGATAGCGTTTACCGGCATGATCCTCTTCTGTATGGCAGCATTAATATTCCCAATAGGATTTTACATCAACGAAGTTGGAGGCCAACCCTACAAATTACCCAACAACACAGTAGTCGGATCATCTTATGTACTTTTTGTTTTATCCATTTTCTTTACAATAGTAGGACTATTATTTGCGGGCAAAGTATGTTTACCTGGTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCTTATTACCTTGAAAAAAAGAAGAAAAATAGACAACTCTAGCCCGTGTCTCAATCCTGCCTCAGATTTCACAAAGAAAAAAACGCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAAACTGACCATCATTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839222
dbEST ID: 79656924
Trimmed Sequence: ACCAGGTAAACATACTTTGCCCGCAAATAATAGTCCTACTATTGTAAAGAAAATGGATAAAACAAAAAGTACATAAGATGATCCGACTACTGTGTTGTTGGGTAATTTGTAGGGTTGGCCTCCAACTTCGTTGATGTAAAATCCTATTGGGAATATTAATGCTGCCATACAGAAGAGGATCATGCCGGTAAACGCTATCCAGCGGGCATATTTTGTAGCTTCTCTTCTCCAATGGGAGGCCACTAGCAAGCCACAAGTAACAGTCAATGATATGATTCCCATGATGATAAAAAACAGAGTGGTTACCCACTCAGGTGGGAGCCTTGGGGGAATACAGGTTCTGTCACGTCCATGAATAGTCTGACATTGTCTGACGAGGCCGACTGTGAGAGCTCCGGCAGACTCCCCTGTGTTGATCCAGTCGGGGTTCGCGATACTGGCGATGGCAAAGATATCCGCANCCAGAAACAAACATCCAGAAATGATGGTCAGTTTATCCATGG
Full Trace Sequence: GCGGGTATANGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACCAGGTAAACATACTTTGCCCGCAAATAATAGTCCTACTATTGTAAAGAAAATGGATAAAACAAAAAGTACATAAGATGATCCGACTACTGTGTTGTTGGGTAATTTGTAGGGTTGGCCTCCAACTTCGTTGATGTAAAATCCTATTGGGAATATTAATGCTGCCATACAGAAGAGGATCATGCCGGTAAACGCTATCCAGCGGGCATATTTTGTAGCTTCTCTTCTCCAATGGGAGGCCACTAGCAAGCCACAAGTAACAGTCAATGATATGATTCCCATGATGATAAAAAACAGAGTGGTTACCCACTCAGGTGGGAGCCTTGGGGGAATACAGGTTCTGTCACGTCCATGAATAGTCTGACATTGTCTGACGAGGCCGACTGTGAGAGCTCCGGCAGACTCCCCTGTGTTGATCCAGTCGGGGTTCGCGATACTGGCGATGGCAAAGATATCCGCANCCAGAAACAAACATCCAGAAATGATGGTCAGTTTATCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAAGGTCACTATCAATCAAAATAAAATCATTATTTTGGGGCCAAAAATAATAACTGTACAGTAAATTTACACGTCCATTGAATTGGGGATGTATCCAACAAAAACCGGGCACGTGGTCAAAAGATCGTGTGATTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAGGTAAACATACTTTGCC