ORFeome > c16orf72 ORF1 – XORFeome v1.0

c16orf72 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c16orf72
Gene ID: 957514
Gene Page ID: 957507
ORF Xenbase ID: 17266881

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060006
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ824448
dbEST ID: 79642150
Trimmed Sequence: ATGGAAGACAAGAAAGAGGAGGGCGAGTCCGAGATTCAGGAGCACGGGCCTGAGCACTGGTTCAGCAAGTGGGAACGACAATGTCTGGCCGAGGCCGAACAGGAAGATCAACCGGAGGAGGAGGCCGAGCAGAGTCAGCAGAAACTCTGGCATCTGTTCCAGAACTCGGCCACCGCGGTGGCGCAGCTCTATAAAGATCGTGTGTGTCAACAACAAGGATTGTCACTTTGGGTCCCTTTCCAGAATGCTGCAACTGCTGTCACAAATCTGTACAAAGAGAGTGTTGATGCACATCAGAGGAGCTTTGACTTAGGAATCCAGATAGGTTATCAAAGACGTAACAAGGATGTATTAGCTTGGGTAAAAAAGCGTCGAAGAACTATTCGAAGAGAGGATTTGATCAGTTTTCTTTGTGGGAAAGTTCCCCCTCCACGGAACTCGCGTGCTCCCCCAAGACTGACTGTTGTATCCCCTAATCGAGCTACTCCAACGGAAACTGGATCATCTGTAGAGACTGATTTGCAGCCTTTCAGAGAAGCAATAGCTCTCCATGGTCTCAGCGGTGCAATGGCTAGTATAAGCGTCCGCTCAAGTACTCCAGGCTCACCAACTCATGTAAGTGGCAGTTCCAACACTGGCCGCAGGAGAAATGGACTTCATGATGTGGACTTAAACACTTTCATATCCGAAGAAATGGCACTCCACTTGGACAATGGTGGCACTAGAAAGCGTTCCTCGGCCNNATGCGGCGATGTCATTACAGACTCACCNANCCATAAACGCAACCAGATGGATCTG
Full Trace Sequence: TAATGATTTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGACAAGAAAGAGGAGGGCGAGTCCGAGATTCAGGAGCACGGGCCTGAGCACTGGTTCAGCAAGTGGGAACGACAATGTCTGGCCGAGGCCGAACAGGAAGATCAACCGGAGGAGGAGGCCGAGCAGAGTCAGCAGAAACTCTGGCATCTGTTCCAGAACTCGGCCACCGCGGTGGCGCAGCTCTATAAAGATCGTGTGTGTCAACAACAAGGATTGTCACTTTGGGTCCCTTTCCAGAATGCTGCAACTGCTGTCACAAATCTGTACAAAGAGAGTGTTGATGCACATCAGAGGAGCTTTGACTTAGGAATCCAGATAGGTTATCAAAGACGTAACAAGGATGTATTAGCTTGGGTAAAAAAGCGTCGAAGAACTATTCGAAGAGAGGATTTGATCAGTTTTCTTTGTGGGAAAGTTCCCCCTCCACGGAACTCGCGTGCTCCCCCAAGACTGACTGTTGTATCCCCTAATCGAGCTACTCCAACGGAAACTGGATCATCTGTAGAGACTGATTTGCAGCCTTTCAGAGAAGCAATAGCTCTCCATGGTCTCAGCGGTGCAATGGCTAGTATAAGCGTCCGCTCAAGTACTCCAGGCTCACCAACTCATGTAAGTGGCAGTTCCAACACTGGCCGCAGGAGAAATGGACTTCATGATGTGGACTTAAACACTTTCATATCCGAAGAAATGGCACTCCACTTGGACAATGGTGGCACTAGAAAGCGTTCCTCGGCCNNATGCGGCGATGTCATTACAGACTCACCNANCCATAAACGCAACCAGATGGATCTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGACAAGAAAGAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ829802
dbEST ID: 79647504
Trimmed Sequence: GATCATTCTGTTGCGTTTATGGGTTGGTGAGTCTGTAATGACATCGCCGCATTGGGCCGAGGAACGCTTTCTAGTGCCACCATTGTCCAAGTGGAGTGCCATTTCTTCGGATATGAAAGTGTTTAAGTCCACATCATGAAGTCCATTTCTCCTGCGGCCAGTGTTGGAACTGCCACTTACATGAGTTGGTGAGCCTGGAGTACTTGAGCGGACGCTTATACTAGCCATTGCACCGCTGAGACCATGGAGAGCTATTGCTTCTCTGAAAGGCTGCAAATCAGTCTCTACAGATGATCCAGTTTCCGTTGGAGTAGCTCGATTAGGGGATACAACAGTCAGTCTTGGGGGAGCACGCGAGTTCCGTGGAGGGGGAACTTTCCCACAAAGAAAACTGATCAAATCCTCTCTTCGAATAGTTCTTCGACGCTTTTTTACCCAAGCTAATACATCCTTGTTACGTCTTTGATAACCTATCTGGATTCCTAAGTCAAAGCTCCTCTGATGTGCATCAACACTCTCTTTGTACAGATTTGTGACAGCAGTTGCAGCATTCTGGAAAGGGACCCAAAGTGACAATCCTTGTTGTTGACACACACGATCTTTATAGAGCTGCGCCCACCGCGGTGGCCGAGTTCTGGGACAGATGGCCAAGTTTCTGCTGACTCTGCTCCGCTCCCTCCTCCGGGTTGATCTTCCCTGTTCGGCCTTCGGCCAGAACATTTTGCGTTCCCCCCTTGGCTGAAACCAAATGCCTCAGGGGCCCGTGGCCTCGGTGAAT
Full Trace Sequence: CCGTGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATCATTCTGTTGCGTTTATGGGTTGGTGAGTCTGTAATGACATCGCCGCATTGGGCCGAGGAACGCTTTCTAGTGCCACCATTGTCCAAGTGGAGTGCCATTTCTTCGGATATGAAAGTGTTTAAGTCCACATCATGAAGTCCATTTCTCCTGCGGCCAGTGTTGGAACTGCCACTTACATGAGTTGGTGAGCCTGGAGTACTTGAGCGGACGCTTATACTAGCCATTGCACCGCTGAGACCATGGAGAGCTATTGCTTCTCTGAAAGGCTGCAAATCAGTCTCTACAGATGATCCAGTTTCCGTTGGAGTAGCTCGATTAGGGGATACAACAGTCAGTCTTGGGGGAGCACGCGAGTTCCGTGGAGGGGGAACTTTCCCACAAAGAAAACTGATCAAATCCTCTCTTCGAATAGTTCTTCGACGCTTTTTTACCCAAGCTAATACATCCTTGTTACGTCTTTGATAACCTATCTGGATTCCTAAGTCAAAGCTCCTCTGATGTGCATCAACACTCTCTTTGTACAGATTTGTGACAGCAGTTGCAGCATTCTGGAAAGGGACCCAAAGTGACAATCCTTGTTGTTGACACACACGATCTTTATAGAGCTGCGCCCACCGCGGTGGCCGAGTTCTGGGACAGATGGCCAAGTTTCTGCTGACTCTGCTCCGCTCCCTCCTCCGGGTTGATCTTCCCTGTTCGGCCTTCGGCCAGAACATTTTGCGTTCCCCCCTTGGCTGAAACCAAATGCCTCAGGGGCCCGTGGCCTCGGTGAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATCATTCTGTTGCGTTTATGGGT