ORFeome > c19orf52 ORF1 – XORFeome v1.0

c19orf52 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c19orf52
Gene ID: 959672
Gene Page ID: 959665
ORF Xenbase ID: 17266947

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123376
Original XGC clone length: 717

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ837526
dbEST ID: 79655228
Trimmed Sequence: ATGGCAGCGCGCTGGATTGGGGTCGTATGGAGGAGGTCGTGCTCCGGTTCCGCGGCTACCGGCCAGGCTACGGAGGCAGTCAAGAAACTGGGACGCTGGGAACGATTCAAGAATGGAAAAATGGCTGTTTGGACAAAGAGCTTGCTGCACGACTATGCCGAGGCCTGTAAGGACATTGTCGTTGGAGCCAAAGAGCGGCCAGGCAAAGCTGCTTTCTACCTGTCCCTTCTTGCAGGTGCCGGGGTCTGTTCCTCCAAGGCCCCAGCGTATGATTCCTTCCAGAGCTGCATGTTAGACGCCTCAGCCTCACTCCTCCTTCTCTCACCCTGGACGAGGAGCAGGAGATCTGATCAGCATGTGCAGAAACTTATGGACCTCAGGAACCAAGGACGATTACGACACCTGGACCTTTTCCTTTTCTCTGTTGTCTATGAAGCCCCCTATGACCCAGACTGTGATCTTTACCCGGCCCACTGCCCACACCTACAGCCTCGCTGGTCACAGTTGCCCAGCAGAGTCCTAGACGTTGGCTTTTTTGGACGTTGGTGGCTTCTCCGTGAGAAGATGGAAGACTTTGATGTGAATGAAGAGGAATTTGCCAGTTTGCCTGCCCCCATGAGAACCATATCCTGGAACGACCTTCATTCAAAAGAGAACGAAAAGCTCTTCCCGCTTAAGTTTCCGGCCAATCACAATGCCAGCCGGAGCAGACCGAATTGCCCAACTTTTCTGGTACAAGTTGGGCATTAATAAAGAAAGCATTGCCTTAATAAATTT
Full Trace Sequence: CGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCGCTGGATTGGGGTCGTATGGAGGAGGTCGTGCTCCGGTTCCGCGGCTACCGGCCAGGCTACGGAGGCAGTCAAGAAACTGGGACGCTGGGAACGATTCAAGAATGGAAAAATGGCTGTTTGGACAAAGAGCTTGCTGCACGACTATGCCGAGGCCTGTAAGGACATTGTCGTTGGAGCCAAAGAGCGGCCAGGCAAAGCTGCTTTCTACCTGTCCCTTCTTGCAGGTGCCGGGGTCTGTTCCTCCAAGGCCCCAGCGTATGATTCCTTCCAGAGCTGCATGTTAGACGCCTCAGCCTCACTCCTCCTTCTCTCACCCTGGACGAGGAGCAGGAGATCTGATCAGCATGTGCAGAAACTTATGGACCTCAGGAACCAAGGACGATTACGACACCTGGACCTTTTCCTTTTCTCTGTTGTCTATGAAGCCCCCTATGACCCAGACTGTGATCTTTACCCGGCCCACTGCCCACACCTACAGCCTCGCTGGTCACAGTTGCCCAGCAGAGTCCTAGACGTTGGCTTTTTTGGACGTTGGTGGCTTCTCCGTGAGAAGATGGAAGACTTTGATGTGAATGAAGAGGAATTTGCCAGTTTGCCTGCCCCCATGAGAACCATATCCTGGAACGACCTTCATTCAAAAGAGAACGAAAAGCTCTTCCCGCTTAAGTTTCCGGCCAATCACAATGCCAGCCGGAGCAGACCGAATTGCCCAACTTTTCTGGTACAAGTTGGGCATTAATAAAGAAAGCATTGCCTTAATAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCGCGCTGGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ837525
dbEST ID: 79655227
Trimmed Sequence: TTCTGTCTGCTCCGCTGGCATTGTGATTGGCCGAAACTTAAGCTGGAAGAGCTTTTCGTTCTCTTCTGAATGAAGGTCGTTCCAGGATATGGTTCTCATGGGGGCAGGCAAACTGGCAAATTCCTCTTCATTCACATCAAAGTCTTCCATCTTCTCACGGAGAAGCCACCAACGTCCAAAAAAGCCAACGTCTAGGACTCTGCTGGGCAACTGTGACCAGCGAGGCTGTAGGTGTGGGCAGTGGGCCGGGTAAAGATCACAGTCTGGGTCATAGGGGGCTTCATAGACAACAAAGAAAAGGAAAAGGTCCAGGTGTCGTAATCGTCCTTGGTTCCTGAGGTCCATAAGTTTCTGCACATGCTGATCAGATCTCCTGCTCCTCGTCCAGGGTGAGAGAAGGAGGAGTGAGGCTGAGGCGTCTAACATGCAGCTCTGGAAGGAATCATACGCTGGGGCCTTGGAGGAACAAACCCCCGCACCTGCAAGAAGGGACAGGTAGAAAGCAGCTTTGCCTGGCCGCTCTTTGGCTCCCACGACCATGTCCTTACAGGCCTCGGCGTAGTCGTTGCGCAAGCTCTTTGTCCAAACAGCCTTTTTTCCATTCTTGAATCCTTCCCAGCCTCGGCCTTTTCTTGACTGCCCCGAAGCGGGACCGGGTAGCCCCGGAAGCCGGAACGCAAACGCGTCGAACCAACCCCAGATCCACCACACCCCCCCATGGTGCCCAACTTTTTTGGGGAAAAAATTTGGGGTTGTGGAAAAAGGG
Full Trace Sequence: GGGGAAAAAGTCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTGTCTGCTCCGCTGGCATTGTGATTGGCCGAAACTTAAGCTGGAAGAGCTTTTCGTTCTCTTCTGAATGAAGGTCGTTCCAGGATATGGTTCTCATGGGGGCAGGCAAACTGGCAAATTCCTCTTCATTCACATCAAAGTCTTCCATCTTCTCACGGAGAAGCCACCAACGTCCAAAAAAGCCAACGTCTAGGACTCTGCTGGGCAACTGTGACCAGCGAGGCTGTAGGTGTGGGCAGTGGGCCGGGTAAAGATCACAGTCTGGGTCATAGGGGGCTTCATAGACAACAAAGAAAAGGAAAAGGTCCAGGTGTCGTAATCGTCCTTGGTTCCTGAGGTCCATAAGTTTCTGCACATGCTGATCAGATCTCCTGCTCCTCGTCCAGGGTGAGAGAAGGAGGAGTGAGGCTGAGGCGTCTAACATGCAGCTCTGGAAGGAATCATACGCTGGGGCCTTGGAGGAACAAACCCCCGCACCTGCAAGAAGGGACAGGTAGAAAGCAGCTTTGCCTGGCCGCTCTTTGGCTCCCACGACCATGTCCTTACAGGCCTCGGCGTAGTCGTTGCGCAAGCTCTTTGTCCAAACAGCCTTTTTTCCATTCTTGAATCCTTCCCAGCCTCGGCCTTTTCTTGACTGCCCCGAAGCGGGACCGGGTAGCCCCGGAAGCCGGAACGCAAACGCGTCGAACCAACCCCAGATCCACCACACCCCCCCATGGTGCCCAACTTTTTTGGGGAAAAAATTTGGGGTTGTGGAAAAAGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGTCTGCTCCGCTGGCATT