ORFeome > c1orf228 ORF1 – XORFeome v1.0

c1orf228 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c1orf228
Gene ID: 1021747
Gene Page ID: 1021744
ORF Xenbase ID: 17266995

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130104
Original XGC clone length: 1230

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ837622
dbEST ID: 79655324
Trimmed Sequence: ATGTCTTTTGTTAAGGAACATGAAGCAGTTACTAGACTTATGGCTTTTCTGAAAGAATGGGACAGAGGTAATAAAGCAACAAGAATTCGAATGCTTAATAATTTCATCTCCTTACATCGGGGAAAGACTGGACCTCAGCTTGAGCAAGAATTCTTCCAGGGTGGCAGTCTGTTCTTTGCGCGATTGACTACATGGCTTAGACTTTCATATATGTTTGGGACATATTTAAGTGAGATTCTCCTGTCAATTGGAATATTTCTGTCTTCTTCAAACAGCAACCGCTATAGTGTTGAATTTGTTGAGGATGGAGGCATTCTGACGCTACTAGAAATTCTTGGATTAAACAATTTGGGGGAACAGCACAAGATTGAAGCTTTAAAACTTCTCCAAATATTGGCAAAAACTGGCAAACAATACAAAGAACTGGTGTGTGAAAGCTATGGTGTACGGATGGTCGCAGAATGTCTGGCAAAGTCAAAAGTAAAAGACACTCAGGAACAAGCACAAGTTGTGTTGGAATTATTGGCTCATGGAAATCCTAAATATCAGTATCAAGTGTATAAAGGATTGATTGCTCTTTTACCCTGTGGGTCCCCGAATGCTCAGCAACTGGCTTTACAGACTCTTAAGGAAATACAGCAAACTTTCAACAGTACTCACCCCACTATAGTGGATTCGCTTTCTGGAGTACTTCAGTCCATGCATCAGGGAATTCAATTAT
Full Trace Sequence: GGGGGCCCAAATAATGGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTTTGTTAAGGAACATGAAGCAGTTACTAGACTTATGGCTTTTCTGAAAGAATGGGACAGAGGTAATAAAGCAACAAGAATTCGAATGCTTAATAATTTCATCTCCTTACATCGGGGAAAGACTGGACCTCAGCTTGAGCAAGAATTCTTCCAGGGTGGCAGTCTGTTCTTTGCGCGATTGACTACATGGCTTAGACTTTCATATATGTTTGGGACATATTTAAGTGAGATTCTCCTGTCAATTGGAATATTTCTGTCTTCTTCAAACAGCAACCGCTATAGTGTTGAATTTGTTGAGGATGGAGGCATTCTGACGCTACTAGAAATTCTTGGATTAAACAATTTGGGGGAACAGCACAAGATTGAAGCTTTAAAACTTCTCCAAATATTGGCAAAAACTGGCAAACAATACAAAGAACTGGTGTGTGAAAGCTATGGTGTACGGATGGTCGCAGAATGTCTGGCAAAGTCAAAAGTAAAAGACACTCAGGAACAAGCACAAGTTGTGTTGGAATTATTGGCTCATGGAAATCCTAAATATCAGTATCAAGTGTATAAAGGATTGATTGCTCTTTTACCCTGTGGGTCCCCGAATGCTCAGCAACTGGCTTTACAGACTCTTAAGGAAATACAGCAAACTTTCAACAGTACTCACCCCACTATAGTGGATTCGCTTTCTGGAGTACTTCAGTCCATGCATCAGGGAATTCAATTAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTTTGTTAAGGAACATGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837621
dbEST ID: 79655323
Trimmed Sequence: GTCGATAGCCTCTTTTGCTCTGGGGATGTTAATTTGATTGGTTGCTAAAAGATCAGCTTGACTCGAGTCTATCTTCATATACAATAACTCAGCATTGTCCATTAGCATTTGGAACAGAGTATCACCAATTGTTTTTCTTACTTGTTCTTCAACAACAGGAAAAGACATAACAAAATACTCTAAAACAAGACTAGCTTGCCTTTGACTTTCACTGTGGTCTCTGTTCCCCATCACAAACAGCAAGTGATGTATTAAACGCAGTTGTATTAACTGTTCACATAGTTCTGTTGATTCCTGAGACACCATTCCTATAGCCCTCACTGCTGCTGCTTGTTGAATGAAAGATGGTAATGGTCCTGAATGTTGTTCAACAGTTGTATCTTCTAAAATTTGTGGTTTAGACTTCTTATTTTCTTTTTGTGAGGGTCTCAGAAGTGCTACTAATCCTTTTAGCAGTGCTGGGCGAACATCAGTATTCATAAGCTCTTTAATAAGTTGGACAGCTTCATACTGAACTTCCTGATGCATTGACTGAAGTACTCCAAGAAGAGAATCCACTATACTGGGGGTGAGTACTGCTGAAAGTTTGCTGTATTTCCCTAAGAGTCTGTAAAGCCAGTTGCTGAACCATTCGGGGAACCACAGGGTAAAAAAGCAAACAATCCTTTATACACTTGATACTTGATATTTAGGAATTTCAATGAACCCCA
Full Trace Sequence: CGGGAATATGCTACTGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGATAGCCTCTTTTGCTCTGGGGATGTTAATTTGATTGGTTGCTAAAAGATCAGCTTGACTCGAGTCTATCTTCATATACAATAACTCAGCATTGTCCATTAGCATTTGGAACAGAGTATCACCAATTGTTTTTCTTACTTGTTCTTCAACAACAGGAAAAGACATAACAAAATACTCTAAAACAAGACTAGCTTGCCTTTGACTTTCACTGTGGTCTCTGTTCCCCATCACAAACAGCAAGTGATGTATTAAACGCAGTTGTATTAACTGTTCACATAGTTCTGTTGATTCCTGAGACACCATTCCTATAGCCCTCACTGCTGCTGCTTGTTGAATGAAAGATGGTAATGGTCCTGAATGTTGTTCAACAGTTGTATCTTCTAAAATTTGTGGTTTAGACTTCTTATTTTCTTTTTGTGAGGGTCTCAGAAGTGCTACTAATCCTTTTAGCAGTGCTGGGCGAACATCAGTATTCATAAGCTCTTTAATAAGTTGGACAGCTTCATACTGAACTTCCTGATGCATTGACTGAAGTACTCCAAGAAGAGAATCCACTATACTGGGGGTGAGTACTGCTGAAAGTTTGCTGTATTTCCCTAAGAGTCTGTAAAGCCAGTTGCTGAACCATTCGGGGAACCACAGGGTAAAAAAGCAAACAATCCTTTATACACTTGATACTTGATATTTAGGAATTTCAATGAACCCCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGATAGCCTCTTTTGCTCTG