ORFeome > c1orf27 ORF1 – XORFeome v1.0

c1orf27 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c1orf27
Gene ID: 964883
Gene Page ID: 964877
ORF Xenbase ID: 17267001

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133748
Original XGC clone length: 1341

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ838469
dbEST ID: 79656171
Trimmed Sequence: ATGGGGAGAAGTTATTATGTAGATGATAGAGTTGAGAAGTATTTCTCTAAGCTTGTCCAACAACCGAAAGGCCGGTATAACAGGGTTAATCATTGGCCAGTATTCATCGCAAAGAGATTATGCAGTTCTGACAGCTCAGACGCCACAAAAAGAGGACCAAAATGAAGAAAAGAAACCTGGTTTGTCCAAGTTGGAGGAAATTGATGATGAATGGGTTTCGATGCATGCTAGCCAGGTGGGGCGCATGCTTCCTGGTGGCTTAATGGTACTGGGTGTTTTCCTTATGACAACTCCAGACCTTTCAAAAGATGCTCAAACTATATTGCGAAAGCTTGTTTTTGCAGGTGAAAAATCATCCATCAAAAACACATTGTGGAAGTTTGATGAAGATGATGTCTCTGACAGAGTGACTCTTCACATCTGTTCCTCAACAAAAAAAATTACCTGCCGGACCTATGATATTAACAATCCAAAGAGCACCCCACCGCCAGCACACTGGAAATGCCGGAGCTCTGTTTTAACTTACTTGACTGTAGACTGTACGGTGCGTGGACATGTAACCATACCCTTCCCGCACCCCCCTCCCCTATCACGAGGGGGGAAATCCAACCAACTCCACATGGTAGTTTGGGCAAGGAAATAAAAAAACCGAAAATCCCCGGGGATCCATAATAGGCGAATAACAGCA
Full Trace Sequence: GACCCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGGAGAAGTTATTATGTAGATGATAGAGTTGAGAAGTATTTCTCTAAGCTTGTCCAACAACCGAAAGGCCGGTATAACAGGGTTAATCATTGGCCAGTATTCATCGCAAAGAGATTATGCAGTTCTGACAGCTCAGACGCCACAAAAAGAGGACCAAAATGAAGAAAAGAAACCTGGTTTGTCCAAGTTGGAGGAAATTGATGATGAATGGGTTTCGATGCATGCTAGCCAGGTGGGGCGCATGCTTCCTGGTGGCTTAATGGTACTGGGTGTTTTCCTTATGACAACTCCAGACCTTTCAAAAGATGCTCAAACTATATTGCGAAAGCTTGTTTTTGCAGGTGAAAAATCATCCATCAAAAACACATTGTGGAAGTTTGATGAAGATGATGTCTCTGACAGAGTGACTCTTCACATCTGTTCCTCAACAAAAAAAATTACCTGCCGGACCTATGATATTAACAATCCAAAGAGCACCCCACCGCCAGCACACTGGAAATGCCGGAGCTCTGTTTTAACTTACTTGACTGTAGACTGTACGGTGCGTGGACATGTAACCATACCCTTCCCGCACCCCCCTCCCCTATCACGAGGGGGGAAATCCAACCAACTCCACATGGTAGTTTGGGCAAGGAAATAAAAAAACCGAAAATCCCCGGGGATCCATAATAGGCGAATAACAGCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGAAGTTATTATGTAGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838468
dbEST ID: 79656170
Trimmed Sequence: CATGATGTAATAAAATGATATTATGATTGCTATGGAGGCTACGATTGTTGATATGACCAGCCCTTTATTTAGAAGAGATGTAGAAGAAGATCTTGCTTTATTTTCTGGTTTGCTTTCCAAGTGCTGTGATGCGGGTTCACTTTCCCTTTTCTCAGGATGAGCCAGTTCGCATTTCTTTTCTGTAAAATCGAGCTCATTTTGTTCCACCTCTTGGTCCATTATCTCAAGAAAATGACTCTGTAAATCAGATGTAGTTTCATCCCCAAACAAATAATCACAGAGCTTTAGATTGGATCCATTAATTGGTACAAATACACGCTGAGGAAGTGGGCGAGCGTCATTTTCATTTGACGGTCCATTAAGCATCATGTCTTCAAATAACAATTCACAACGGTCCTGGATTGTATTCAGAAAATCTCTTTTAATAACCTGCATGGCATCCTTCACTTTTGGCCTGTTGCTGTGGATGAACCCACGGCATTTGCTGACTCCTTGAGTAGTTAGAGATAACTTGCACGCCTGAACCAACACTGTGGACCTGGTGTTGTCAATGAATGATAAGGCATTGAGAAAGTTGGCTGTGTAGGCGGGAAAAATGGAATGAACCAAAGAGGGGAAATAACTTTTGCTTTTTTCCAAAAAATAAAGGGGGTTT
Full Trace Sequence: GGGTACTCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATGTAATAAAATGATATTATGATTGCTATGGAGGCTACGATTGTTGATATGACCAGCCCTTTATTTAGAAGAGATGTAGAAGAAGATCTTGCTTTATTTTCTGGTTTGCTTTCCAAGTGCTGTGATGCGGGTTCACTTTCCCTTTTCTCAGGATGAGCCAGTTCGCATTTCTTTTCTGTAAAATCGAGCTCATTTTGTTCCACCTCTTGGTCCATTATCTCAAGAAAATGACTCTGTAAATCAGATGTAGTTTCATCCCCAAACAAATAATCACAGAGCTTTAGATTGGATCCATTAATTGGTACAAATACACGCTGAGGAAGTGGGCGAGCGTCATTTTCATTTGACGGTCCATTAAGCATCATGTCTTCAAATAACAATTCACAACGGTCCTGGATTGTATTCAGAAAATCTCTTTTAATAACCTGCATGGCATCCTTCACTTTTGGCCTGTTGCTGTGGATGAACCCACGGCATTTGCTGACTCCTTGAGTAGTTAGAGATAACTTGCACGCCTGAACCAACACTGTGGACCTGGTGTTGTCAATGAATGATAAGGCATTGAGAAAGTTGGCTGTGTAGGCGGGAAAAATGGAATGAACCAAAGAGGGGAAATAACTTTTGCTTTTTTCCAAAAAATAAAGGGGGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATGTAATAAAATGA