ORFeome > c1orf52 ORF2 – XORFeome v1.0

c1orf52 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c1orf52
Gene ID: 6254710
Gene Page ID: 975904
ORF Xenbase ID: 17267019

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108757
Original XGC clone length: 507

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ837713
dbEST ID: 79655415
Trimmed Sequence: ATGGCTGCTGAAGAGAAGGATCCCTTAAGCTTCTTTGCTGCTTATGGAAGTAGCAGCTCGGATTCGGACAGCAGCGACGAAGAGAAAGAAGCAGAGAAAACTAAGAACCGCGCAACAAAGCGACCTTTTCCCACAGAAACTAAAAAGCTGCCGGGGCCGGACGAACTGTTCCGGAGTGTTTCTCGCCCCGCCTTCCTCTACAACCCACTCAACAAGCAGATAGACTGGGAGAGTCGGGTGAAGCGGGCCCCAGAAGAGCCTCCTAAAGAGTTTAAAGTATGGAAGACAAATGCTGTCCCACCACCGGAGTCCTACCAAGTAGCCGAGAAGAAAGCTCCACCCCCTGAACTGGACATGGCTATCAAATGGTCGAACGTGTACCAAGACAACGGTGATGATGCACCACATGCAAACCAAGCTAAGTGTCTACCAGAGGAAGAAGCTCAAGAAGATTCTCCACCTTCGGATGATGAGCAAGAGAACGCCACAAAAAAGCATAAAGTCTT
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGAAGAGAAGGATCCCTTAAGCTTCTTTGCTGCTTATGGAAGTAGCAGCTCGGATTCGGACAGCAGCGACGAAGAGAAAGAAGCAGAGAAAACTAAGAACCGCGCAACAAAGCGACCTTTTCCCACAGAAACTAAAAAGCTGCCGGGGCCGGACGAACTGTTCCGGAGTGTTTCTCGCCCCGCCTTCCTCTACAACCCACTCAACAAGCAGATAGACTGGGAGAGTCGGGTGAAGCGGGCCCCAGAAGAGCCTCCTAAAGAGTTTAAAGTATGGAAGACAAATGCTGTCCCACCACCGGAGTCCTACCAAGTAGCCGAGAAGAAAGCTCCACCCCCTGAACTGGACATGGCTATCAAATGGTCGAACGTGTACCAAGACAACGGTGATGATGCACCACATGCAAACCAAGCTAAGTGTCTACCAGAGGAAGAAGCTCAAGAAGATTCTCCACCTTCGGATGATGAGCAAGAGAACGCCACAAAAAAGCATAAAGTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTATCTGGCAAATAAGGACCGAGTACAAACTTCTCTGAGTGTTACAAGGAGGAAGGGGGGGGGGGGGGGTGTGTCTTTCATTCCTTCGCCGCACGGGGGGGGGGGAGGGGGGAGCGCGGCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGCTGAAGAGAAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837712
dbEST ID: 79655414
Trimmed Sequence: GACTTTATGCTTTTTTGTGGCGTTCTCTTGCTCATCATCCGAAGGTGGAGAATCTTCTTGAGCTTCTTCCTCTGGTAGACACTTAGCTTGGTTTGCATGTGGTGCATCATCACCGTTGTCTTGGTACACGTTCGACCATTTGATAGCCATGTCCAGTTCAGGGGGTGGAGCTTTCTTCTCGGCTACTTGGTAGGACTCCGGTGGTGGGACAGCATTTGTCTTCCATACTTTAAACTCTTTAGGAGGCTCTTCTGGGGCCCGCTTCACCCGACTCTCCCAGTCTATCTGCTTGTTGAGTGGGTTGTAGAGGAAGGCGGGGCGAGAAACACTCCGGAACAGTTCGTCCGGCCCCGGCAGCTTTTTAGTTTCTGTGGGAAAAGGTCGCTTTGTTGCGCGGTTCTTAGTTTTCTCTGCTTCTTTCTCTTCGTCACTGCTGTCCGAATCCGAGCTGCTACTTCCATAATCAACAAAGAAGCTTAATGGATCCTTCTCTTCAGCACCCATGG
Full Trace Sequence: GGGCAGGGGAACAGCTTATGAACCATGTAATACGACTCACTACTAGGGGAAACCAGCTTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACTTTATGCTTTTTTGTGGCGTTCTCTTGCTCATCATCCGAAGGTGGAGAATCTTCTTGAGCTTCTTCCTCTGGTAGACACTTAGCTTGGTTTGCATGTGGTGCATCATCACCGTTGTCTTGGTACACGTTCGACCATTTGATAGCCATGTCCAGTTCAGGGGGTGGAGCTTTCTTCTCGGCTACTTGGTAGGACTCCGGTGGTGGGACAGCATTTGTCTTCCATACTTTAAACTCTTTAGGAGGCTCTTCTGGGGCCCGCTTCACCCGACTCTCCCAGTCTATCTGCTTGTTGAGTGGGTTGTAGAGGAAGGCGGGGCGAGAAACACTCCGGAACAGTTCGTCCGGCCCCGGCAGCTTTTTAGTTTCTGTGGGAAAAGGTCGCTTTGTTGCGCGGTTCTTAGTTTTCTCTGCTTCTTTCTCTTCGTCACTGCTGTCCGAATCCGAGCTGCTACTTCCATAATCAACAAAGAAGCTTAATGGATCCTTCTCTTCAGCACCCATGGTGCCGACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCGTCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGNGCAAAAAATAAAGAGAAAAAAATCAATAAAAAGTTAACCGACTAAGAGGCAGAGGCGGGGGGGGTAAAATTCCAATGCGCCCATGGGAGGGGGGGGGCGCCCCTTTTGAAAATGGTAAAGGGAAAAAAAAAACAAAAATAAGCCTAGTTCCGGTCGGGAAGGTGAAGGGAAAGTACGGACACCGCTCCCAAACGGGGCAAAAACCTTGTCAAAACAAAGAAGGGTAAGCTGGCGTTTGGTGTTTTTAGGTGTTTTTATAGAGTGNTATTTGGGGGAGAGAGAAAAAACAGCGCGGGCGGGGGAGGGAGATAGTTNGATGTGAGGGGGGAGAGGGGAGGAGAGNGGAGAGAGAAAANAAGGAAGAAGAAAAAGAAAAAGAGAGGAAAGNAGAGAGGGGAAGAGGAGAGGGGGGGGGGGAGAGGGAAGGAGAGAAGGANGAGAGGGGGAGGGGGGGGGAGGGAAAGCGGGAGGGAGAGGAGGGGCCAGGGAGAGAGAGGGGANGGGGAAGAAGAGAGAGGGGGGNGAGGGCGNGGGAGGGAGGGGGNAAGGGGGGGAGNAAGTGGGAGGGGAAGGGGGNGAGANAGGGGGNGGAGAAGGAANGGGAGNGAAGGAGAAAAAAAGGAAGGNNGAAGGGNNAGAANAAGAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTTATGCTTTTTTGTGGCGTT