ORFeome > c1qbp ORF1 – XORFeome v1.0

c1qbp ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: c1qbp
Gene ID: 973235
Gene Page ID: 973231
ORF Xenbase ID: 17267037

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC056846
Original XGC clone length: 579

Human orthology & disease relationships

NCBI Entrez ID: 708
Ensembl gene IDs: ENSG00000108561
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 106100,114500,121900,122200,132600,155255,166200,166210,166220,188050,202400,231200,600652,603278,607541,607841,608470,608471

Library Location

Plate ID: GDExl11002
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ839371
dbEST ID: 79657073
Trimmed Sequence: ATGAAATCAAAGAAGAGAAAAAAAATTCAAAAACATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTT
Full Trace Sequence: CGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAATCAAAGAAGAGAAAAAAAATTCAAAAACATAAGAACCTTCCTAAAATGTCTGGTGGATGGGAACTTGAGGTTAATGGCACAGAGGCTAAACTGGTCAGAAAAATTTCTGGTGAAACGATTACAGTCACTTTCAACACAAATAATAGCATTCCACCAAGTTTTAATGAGGAGCCACAAGAAGGTCAGAAGGCAGAGGAGAATGAGCCTGAGCTTGTGTCTACTCCCAATTTTGTGGTAGAAGTTCTAAAAATGGATACCAACCAGACCCTGGTTCTTGACTGTCACTATCCAGAAGATGAGGTTGGACATGGGGAAGAAGAGGAAGAAAGTGACATTTTCACTATCCGGGAGGTTAGCTTTCAACCCACAGGAGACACAGAATGGAAGGAGAACAGCTATACTCTTAACACTGATTCACTTGACTGGGCCCTTTATGACCACTTGATGGATTTTTTGGCTGACCGTGGAGTGGATAATACTTTTGCTGATGAGCTAGTGGAACTCAGCACTGCTTTGGAACACCATGAATACATCAAGTTTCTAGAAAATCTTAAAGACTTTGTCAAATGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTTGCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATTCACCTGATATCCCCCTATATTGATTCGTAATACTTGGTTAAAAAACAATATACCTAACAAACTCTAGGCCCGTGCCTCAAAAAACACCCATAAAAATTAAAAAAAGNAAAAAAAAAAAAAAAGGAACGCGGCNNAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATCAAAGAAGAGAAAAAAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839370
dbEST ID: 79657072
Trimmed Sequence: GCATTTGACAAAGTCTTTAAGATTTTCTAGAAACTTGATGTATTCATGGTGTTCCAAAGCAGTGCTGAGTTCCACTAGCTCATCAGCAAAAGTATTATCCACTCCACGGTCAGCCAAAAAATCCATCAAGTGGTCATAAAGGGCCCAGTCAAGTGAATCAGTGTTAAGAGTATAGCTGTTCTCCTTCCATTCTGTGTCTCCTGTGGGTTGAAAGCTAACCTCCCGGATAGTGAAAATGTCACTTTCTTCCTCTTCTTCCCCATGTCCAACCTCATCTTCTGGATAGTGACAGTCAAGAACCAGGGTCTGGTTGGTATCCATTTTTAGAACTTCTACCACAAAATTGGGAGTAGACACAAGCTCAGGCTCATTCTCCTCTGCCTTCTGACCTTCTTGTGGCTCCTCATTAAAACTTGGTGGAATGCTATTATTTGTGTTGAAAGTGACTGTAATCGTTTCACCAGAAATTTTTCTGACCCGTTTAGCCTCTGTGCCATTAACCTCAAGTTTCCATCCACCAGAACTTTTAGGAAGGTTCTTATGTTTTTGAATTTTTTTTCTCTTTCTTGTTTTCTGGGGGC
Full Trace Sequence: CGGGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCATTTGACAAAGTCTTTAAGATTTTCTAGAAACTTGATGTATTCATGGTGTTCCAAAGCAGTGCTGAGTTCCACTAGCTCATCAGCAAAAGTATTATCCACTCCACGGTCAGCCAAAAAATCCATCAAGTGGTCATAAAGGGCCCAGTCAAGTGAATCAGTGTTAAGAGTATAGCTGTTCTCCTTCCATTCTGTGTCTCCTGTGGGTTGAAAGCTAACCTCCCGGATAGTGAAAATGTCACTTTCTTCCTCTTCTTCCCCATGTCCAACCTCATCTTCTGGATAGTGACAGTCAAGAACCAGGGTCTGGTTGGTATCCATTTTTAGAACTTCTACCACAAAATTGGGAGTAGACACAAGCTCAGGCTCATTCTCCTCTGCCTTCTGACCTTCTTGTGGCTCCTCATTAAAACTTGGTGGAATGCTATTATTTGTGTTGAAAGTGACTGTAATCGTTTCACCAGAAATTTTTCTGACCCGTTTAGCCTCTGTGCCATTAACCTCAAGTTTCCATCCACCAGAACTTTTAGGAAGGTTCTTATGTTTTTGAATTTTTTTTCTCTTTCTTGTTTTCTGGGGGCCAACTTTTTTTGTCCAAGGTGGGCATTATAAAAAAGCATTGCCCATCCAATTTTTTGCACGAAACGGTCACTATAAGTTCAAAAAAAAAAAAAAAAATTAAGGGCCCGAACCTTAAGAACGGGGCCCGCTGTTTTAAAAAACCACATGAGACGAGGGGGTNTTTTCCCANCAGGGTGAGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCATTTGACAAAGTCTTTAAGAT